Her2 (ERBB2) Human Gene Knockout Kit (CRISPR)
CAT#: KN212583BN
ERBB2 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
CNY 3710.00
CNY 1999.00
CNY 2700.00
CNY 8736.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
Donor DNA | mBFP-Neo |
Symbol | Her2 |
UniProt ID | P04626 |
Locus ID | 2064 |
Kit Components |
KN212583G1, Her2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TGTGGCTTCCAGGACCCCCG KN212583G2, Her2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GATGTGTTGTGTTTACCTTG KN212583BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001005862, NM_001289936, NM_001289937, NM_001289938, NM_004448, NR_110535 |
Synonyms | CD340; HER-2; HER-2/neu; HER2; MLN 19; NEU; NGL; TKR1 |
Summary | This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN212583 | ERBB2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN212583LP | ERBB2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN212583RB | ERBB2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN412583 | ERBB2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
GA101441 | ERBB2 CRISPRa kit - CRISPR gene activation of human erb-b2 receptor tyrosine kinase 2 |
CNY 12255.00 |