Human Her2 (ERBB2) activation kit by CRISPRa

CAT#: GA101441

ERBB2 CRISPRa kit - CRISPR gene activation of human erb-b2 receptor tyrosine kinase 2



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Cited in 1 publication.

Product images

推荐一起购买 (3)
ERBB2 mouse monoclonal antibody, clone OTI4F10 (formerly 4F10)
    • 100 ul

CNY 1999.00
CNY 2700.00


ERBB2 (Myc-DDK-tagged)-Human v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) (ERBB2), transcript variant 1
    • 10 ug

CNY 8736.00


HER2 (ERBB2) Mouse Monoclonal Antibody, clone 16F12-11
    • 30 ul

CNY 1800.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol ERBB2
Locus ID 2064
Kit Components

GA101441G1, Her2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCCAGGGAGAAAGGATGGC

GA101441G2, Her2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGGTTGGTCCTGCTAGCTG

GA101441G3, Her2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTACGCAGTCGCGGTACAC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_001005862, NM_001289936, NM_001289937, NM_001289938, NM_004448, NR_110535
Synonyms CD340; HER-2; HER-2/neu; HER2; MLN 19; NEU; NGL; TKR1
Summary This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Other Versions

Customer Reviews 
Loading...