VLDL Receptor (VLDLR) Human Gene Knockout Kit (CRISPR)
CAT#: KN211796BN
VLDLR - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
Specifications
| Product Data | |
| Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
| Donor DNA | mBFP-Neo |
| Symbol | VLDL Receptor |
| UniProt ID | P98155 |
| Locus ID | 7436 |
| Kit Components |
KN211796G1, VLDL Receptor gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GAGAGCGGCGCCACCGGAAC KN211796G2, VLDL Receptor gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CGTCCGCGCTCTGGGCGCTC KN211796BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
| Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
| Reference Data | |
| RefSeq | NM_001018056, NM_003383, NM_001322225, NM_001322226 |
| Synonyms | CAMRQ1; CARMQ1; CHRMQ1; VLDLRCH |
| Summary | The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009] |
Documents
| Product Manuals |
| FAQs |
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN211796 | VLDLR - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN211796LP | VLDLR - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN211796RB | VLDLR - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN411796 | VLDLR - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
| GA105126 | VLDLR CRISPRa kit - CRISPR gene activation of human very low density lipoprotein receptor |
CNY 12255.00 |
其它VLDL Receptor产品
