DR4 (TNFRSF10A) Human Gene Knockout Kit (CRISPR)
CAT#: KN202152LP
TNFRSF10A - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
CNY 3710.00
CNY 1999.00
CNY 2700.00
CNY 5488.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control |
Donor DNA | Luciferase-Puro |
Symbol | DR4 |
Locus ID | 8797 |
Kit Components |
KN202152G1, DR4 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CTCGCTGCGCTCCCGGGATT KN202152G2, DR4 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AGTACATCTAGGTGCGTTCC KN202152LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_003844 |
Synonyms | APO2; CD261; DR4; TRAILR-1; TRAILR1 |
Summary | The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL), and thus transduces cell death signal and induces cell apoptosis. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN202152 | TNFRSF10A - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN202152BN | TNFRSF10A - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN202152RB | TNFRSF10A - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN402152 | TNFRSF10A - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
GA105843 | TNFRSF10A CRISPRa kit - CRISPR gene activation of human TNF receptor superfamily member 10a |
CNY 12255.00 |