DR4 (TNFRSF10A) Human Gene Knockout Kit (CRISPR)

CAT#: KN202152LP

TNFRSF10A - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


TNFRSF10A mouse monoclonal antibody, clone OTI8A12 (formerly 8A12)
    • 100 ul

CNY 1999.00
CNY 2700.00


TNFRSF10A (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A)
    • 10 ug

CNY 5488.00

Specifications

Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA Luciferase-Puro
Symbol DR4
UniProt ID O00220
Locus ID 8797
Kit Components

KN202152G1, DR4 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CTCGCTGCGCTCCCGGGATT

KN202152G2, DR4 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AGTACATCTAGGTGCGTTCC

KN202152LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_003844
Synonyms APO2; CD261; DR4; TRAILR-1; TRAILR1
Summary The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL), and thus transduces cell death signal and induces cell apoptosis. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...