Human Kallikrein 2 (KLK2) activation kit by CRISPRa
CAT#: GA102587
KLK2 CRISPRa kit - CRISPR gene activation of human kallikrein related peptidase 2
CNY 12255.00
CNY 1999.00
CNY 2700.00
CNY 3600.00
CNY 3705.00
CNY 800.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | KLK2 |
| Locus ID | 3817 |
| Kit Components | GA102587G1, Kallikrein 2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAATCTGACCTCACACCGT GA102587G2, Kallikrein 2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACATACTAGATCAGTCTGG GA102587G3, Kallikrein 2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTCAGCATCTAGGTGCCAAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_001002231, NM_001002232, NM_001256080, NM_005551, NR_045762, NR_045763 |
| Synonyms | hGK-1; hK2; KLK2A2 |
| Summary | This gene encodes a member of the grandular kallikrein protein family. Kallikreins are a subgroup of serine proteases that are clustered on chromosome 19. Members of this family are involved in a diverse array of biological functions. The protein encoded by this gene is a highly active trypsin-like serine protease that selectively cleaves at arginine residues. This protein is primarily expressed in prostatic tissue and is responsible for cleaving pro-prostate-specific antigen into its enzymatically active form. This gene is highly expressed in prostate tumor cells and may be a prognostic maker for prostate cancer risk. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Jan 2012] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN202667 | KLK2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN202667BN | KLK2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN202667LP | KLK2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN202667RB | KLK2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN402667 | KLK2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
