Human HSF1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	HSF1
Locus ID	3297
Kit Components	GA102251G1, HSF1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGTGGGACCAACACGCGC GA102251G2, HSF1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACTGGAGCCTGAGCCCGAGC GA102251G3, HSF1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGCCCAAGACCGATTCACT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_005526
Synonyms	HSTF1
Summary	The product of this gene is a transcription factor that is rapidly induced after temperature stress and binds heat shock promoter elements (HSE). This protein plays a role in the regulation of lifespan. Expression of this gene is repressed by phosphorylation, which promotes binding by heat shock protein 90. [provided by RefSeq, Jul 2017]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.