Human HNF 4 alpha (HNF4A) activation kit by CRISPRa
CAT#: GA102164
HNF4A CRISPRa kit - CRISPR gene activation of human hepatocyte nuclear factor 4 alpha
CNY 12255.00
CNY 1999.00
CNY 2700.00
CNY 5488.00
CNY 800.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | HNF4A |
Locus ID | 3172 |
Kit Components | GA102164G1, HNF 4 alpha gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCACTTAGGGAACCCGCGGC GA102164G2, HNF 4 alpha gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTCCATGGCAATGGCGACC GA102164G3, HNF 4 alpha gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACCCGAGTGGACCTCAGGTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_000457, NM_001030003, NM_001030004, NM_001258355, NM_001287182, NM_001287183, NM_001287184, NM_175914, NM_178849, NM_178850 |
Synonyms | FRTS4; HNF4; HNF4a7; HNF4a8; HNF4a9; HNF4alpha; MODY; MODY1; NR2A1; NR2A21; TCF; TCF14 |
Summary | The protein encoded by this gene is a nuclear transcription factor which binds DNA as a homodimer. The encoded protein controls the expression of several genes, including hepatocyte nuclear factor 1 alpha, a transcription factor which regulates the expression of several hepatic genes. This gene may play a role in development of the liver, kidney, and intestines. Mutations in this gene have been associated with monogenic autosomal dominant non-insulin-dependent diabetes mellitus type I. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Apr 2012] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN411443 | HNF4A - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |