CPEB1 (NM_001288820) Human Untagged Clone

CAT#: SC335415

CPEB1 (untagged) - Human cytoplasmic polyadenylation element binding protein 1 (CPEB1), transcript variant 6



  "NM_001288820" in other vectors (2)

CNY 3230.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal CPEB1 Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CPE-BP1; CPEB; CPEB-1; h-CPEB; hCPEB-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335415 representing NM_001288820.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGGTAGGGTCTCGGATGGACCAAGAGCAAGCTGCTCTTGCTGCAGTCACTCCCTCCCCAACCAGT
GCTTCAAAGAGATGGCCAGGAGCTTCTGTGTGGCCATCCTGGGACCTCCTCGAAGCTCCCAAAGACCCC
TTCAGCATAGAGAGAGAGGCCAGGCTGCACCGACAAGCTGCAGCTGTGAATGAAGCCACCTGTACCTGG
AGTGGCCAGCTTCCTCCCCGGAACTATAAGAACCCCATCTACTCTTGCAAGGTGTTTCTAGGAGGTGTT
CCTTGGGATATTACAGAAGCTGGATTAGTTAACACCTTCCGTGTTTTTGGCTCTTTGAGTGTGGAGTGG
CCTGGTAAGGATGGCAAGCATCCCCGGTGTCCTCCCAAAGGGTATGTGTATCTGGTCTTCGAACTAGAG
AAGTCTGTCCGATCCTTGCTTCAGGCTTGCTCTCATGACCCGCTGAGCCCAGATGGCCTGAGTGAATAT
TATTTCAAGATGTCCAGCCGAAGGATGCGCTGCAAGGAGGTGCAGGTGATCCCCTGGGTATTAGCCGAC
AGTAACTTTGTCCGGAGCCCATCTCAGAGGCTTGACCCCAGCAGGACGGTGTTTGTCGGTGCTCTGCAT
GGAATGCTAAATGCTGAGGCCCTGGCAGCCATCTTGAACGACCTATTTGGTGGAGTGGTGTATGCCGGG
ATTGACACAGATAAGCACAAGTATCCCATTGGTTCTGGTCGTGTGACTTTCAATAACCAACGGAGTTAC
CTGAAAGCAGTCAGCGCTGCTTTTGTGGAGATCAAAACCACCAAGTTCACAAAGAAGGTTCAGATTGAC
CCCTACCTAGAAGATTCTCTGTGTCATATCTGCAGTTCTCAGCCTGGTCCTTTCTTCTGTCGAGATCAG
GTCTGCTTCAAATACTTCTGCCGGAGCTGCTGGCACTGGCGGCACAGCATGGAGGGCCTGCGCCACCAC
AGCCCCCTGATGCGGAACCAGAAGAACCGAGATTCCAGCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001288820
Insert Size 1008 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001288820.1
RefSeq Size 2868 bp
RefSeq ORF 1008 bp
Locus ID 64506
Protein Pathways Dorso-ventral axis formation, Oocyte meiosis, Progesterone-mediated oocyte maturation
MW 37.7 kDa
Gene Summary This gene encodes a member of the cytoplasmic polyadenylation element binding protein family. This highly conserved protein binds to a specific RNA sequence, called the cytoplasmic polyadenylation element, found in the 3' untranslated region of some mRNAs. The encoded protein functions in both the cytoplasm and the nucleus. It is involved in the regulation of mRNA translation, as well as processing of the 3' untranslated region, and may play a role in cell proliferation and tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (6) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...