B3GAT3 (NM_001288723) Human Untagged Clone

CAT#: SC335287

B3GAT3 (untagged) - Human beta-1,3-glucuronyltransferase 3 (B3GAT3), transcript variant 4



  "NM_001288723" in other vectors (2)

CNY 3040.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-B3GAT3 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GLCATI; glcUAT-I; JDSCD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335287 representing NM_001288723.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGCTGAAGCTGAAGAACGTGTTTCTCGCCTACTTCCTGGTGTCGATCGCCGGCCTCCTCTACGCG
CTGGTACAGCTCGGCCAGCCATGTGACTGCCTTCCTCCCCTGCGGGCAGCAGCCGAGCAGCTACGGCAG
AAGGATCTGAGGATTTCCCAGCTGCAAGCGGAACTCCGACGGCCACCCCCTGCCCCTGCCCAGCCCCCT
GAACCCGAGGCCCTGCCTACTATCTATGTTGTTACCCCCACCTATGCCAGGCTGGTACAGAAGGCAGAG
CTGGTACGACTGTCCCAGACACTGAGCCTGGTGCCCCGGCTGCATTGGCTGCTGGTGGAGGATGCTGAG
GGTCCCACCCCGCTGGTCTCAGGGCTGCTGGCTGCCTCTGGCCTCCTCTTCACACACCTGGTGGTCCTC
ACGCCCAAAGCCCAGCGGCTTCGGGAGGGCGAGCCTGGCTGGGTTCATCCCCGTGGTGTCGAGCAGCGG
AACAAGGCCCTGGACTGGCTCCGGGGCAGAGGGGGTGCTGTGGGTGGGGAGAAGGACCCACCACCACCA
GGGACCCAAGGAGTCGTCTACTTTGCTGACGATGACAACACCTACAGCCGGGAGCTGTTTGAGGAGATG
CGCTGGACCCGTGGTGTCTCAGTGTGGCCTGTGGGGCTGGTGGGCGGCCTGCGATTCGAGGGCCCTCAG
GTACAGGACGGCCGGGTAGTGGGCTTCCACACAGCATGGGAGCCCAGCAGGCCCTTCCCTGTGGATATG
GCTGGATTTGCCGTGGCCCTGCCCTTGCTGTTAGATAAGCCCAATGCCCAATTTGATTCCACCGCTCCC
CGGGGCCACCTGGAGAGCAGTCTTCTGAGCCACCTTGTGGATCCCAAGGACCTGGAGCCACGGGCTGCC
AACTGCACTCGGACAGAGTCTCGCTGTGTCACCCAGGCTGGAGTGCAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001288723
Insert Size 948 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001288723.1
RefSeq Size 2098 bp
RefSeq ORF 948 bp
Locus ID 26229
UniProt ID O94766
Protein Families Transmembrane
Protein Pathways Chondroitin sulfate biosynthesis, Heparan sulfate biosynthesis, Metabolic pathways
MW 34.6 kDa
Gene Summary The protein encoded by this gene is a member of the glucuronyltransferase gene family, enzymes that exhibit strict acceptor specificity, recognizing nonreducing terminal sugars and their anomeric linkages. This gene product catalyzes the formation of the glycosaminoglycan-protein linkage by way of a glucuronyl transfer reaction in the final step of the biosynthesis of the linkage region of proteoglycans. A pseudogene of this gene has been identified on chromosome 3. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (4) uses an alternate splice site in its 3' coding region, compared to variant 1. The encoded isoform (4) has a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...