PEX11C (PEX11G) (NM_001300881) Human Untagged Clone
CAT#: SC334143
PEX11G (untagged) - Human peroxisomal biogenesis factor 11 gamma (PEX11G), transcript variant 3
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300881, the custom clone sequence may differ by one or more nucleotides
ATGTTTGTCTACACTAAGCAATATGGCCTGGGGGCACAGGAGGAGGACGCCTTTGTCCGCTGTGTCTCCG TCCTAGGGAACCTGGCTGACCAGCTCTACTACCCCTGTGAGCACGTGGCCTGGGCGGCTGATGCCCGGGT CCTCCACGTGGACTCTTCTCGGTGGTGGACGCTGAGTACAACCCTGTGGGCCCTCTCTCTGCTCCTGGGG GTTGCCAGGTCCCTGTGGATGCTGCTGAAACTGAGACAGAGGCTGCGGAGCCCCACGGCGCCCTTCACCA GCCCGCTGCCCCGGGGCAAGCGGAGGGCCATGGAGGCGCAGATGCAGTCGGAGGCGCTGTCACTTCTCAG CAACCTGGCCGACCTGGCCAACGCCGTGCACTGGCTGCCCCGGGGCGTGCTGTGGGCCGGCCGCTTCCCG CCGTGGCTAGTGGGCCTCATGGGCACCATCTCCTCAATCCTCAGCATGTACCAGGCGGCCCGGGCCGGCG GCCAGGCCGAGGCCACTACCCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300881 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001300881.1, NP_001287810.1 |
RefSeq Size | 1061 bp |
RefSeq ORF | 516 bp |
Locus ID | 92960 |
UniProt ID | Q96HA9 |
Gene Summary | The protein encoded by this gene is a member of the PEX11 family. This family is reported to regulate the number and size of peroxisomes in evolutionarily distant organisms. The protein encoded by this gene may induce clustering of peroxisomes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (3) contains an alternate 3' terminal exon, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 3, which has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...