FLI1 (NM_001271010) Human Untagged Clone

CAT#: SC333024

FLI1 (untagged) - Homo sapiens Fli-1 proto-oncogene, ETS transcription factor (FLI1), transcript variant 3



  "NM_001271010" in other vectors (2)

CNY 3710.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-FLI1 Antibody
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BDPLT21; EWSR2; SIC-1
Vector pCMV6-Entry
Sequence Data
>SC333024 representing NM_001271010.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGGGAGGACTGGCAGGCGAGCGGGCGAGGGAGTCTCCGGTGGACTGCAGCGTTAGCAAATGCAGC
AAGCTGGTGGGCGGAGGCGAGTCCAACCCCATGAACTACAACAGCTATATGGACGAGAAGAATGGCCCC
CCTCCTCCCAACATGACCACCAACGAGAGGAGAGTCATCGTCCCCGCAGACCCCACACTGTGGACACAG
GAGCATGTGAGGCAATGGCTGGAGTGGGCCATAAAGGAGTACAGCTTGATGGAGATCGACACATCCTTT
TTCCAGAACATGGATGGCAAGGAACTGTGTAAAATGAACAAGGAGGACTTCCTCCGCGCCACCACCCTC
TACAACACGGAAGTGCTGTTGTCACACCTCAGTTACCTCAGGGAAAGTTCACTGCTGGCCTATAATACA
ACCTCCCACACCGACCAATCCTCACGATTGAGTGTCAAAGAAGACCCTTCTTATGACTCAGTCAGAAGA
GGAGCTTGGGGCAATAACATGAATTCTGGCCTCAACAAAAGTCCTCCCCTTGGAGGGGCACAAACGATC
AGTAAGAATACAGAGCAACGGCCCCAGCCAGATCCGTATCAGATCCTGGGCCCGACCAGCAGTCGCCTA
GCCAACCCTGGAAGCGGGCAGATCCAGCTGTGGCAATTCCTCCTGGAGCTGCTCTCCGACAGCGCCAAC
GCCAGCTGTATCACCTGGGAGGGGACCAACGGGGAGTTCAAAATGACGGACCCCGATGAGGTGGCCAGG
CGCTGGGGCGAGCGGAAAAGCAAGCCCAACATGAATTACGACAAGCTGAGCCGGGCCCTCCGTTATTAC
TATGATAAAAACATTATGACCAAAGTGCACGGCAAAAGATATGCTTACAAATTTGACTTCCACGGCATT
GCCCAGGCTCTGCAGCCACATCCGACCGAGTCGTCCATGTACAAGTACCCTTCTGACATCTCCTACATG
CCTTCCTACCATGCCCACCAGCAGAAGGTGAACTTTGTCCCTCCCCATCCATCCTCCATGCCTGTCACT
TCCTCCAGCTTCTTTGGAGCCGCATCACAATACTGGACCTCCCCCACGGGGGGAATCTACCCCAACCCC
AACGTCCCCCGCCATCCTAACACCCACGTGCCTTCACACTTAGGCAGCTACTACTAG

Restriction Sites SgfI-MluI     
ACCN NM_001271010
Insert Size 1161 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271010.1
RefSeq Size 4166 bp
RefSeq ORF 1161 bp
Locus ID 2313
UniProt ID Q01543
Protein Families Transcription Factors
MW 43.6 kDa
Gene Summary This gene encodes a transcription factor containing an ETS DNA-binding domain. The gene can undergo a t(11;22)(q24;q12) translocation with the Ewing sarcoma gene on chromosome 22, which results in a fusion gene that is present in the majority of Ewing sarcoma cases. An acute lymphoblastic leukemia-associated t(4;11)(q21;q23) translocation involving this gene has also been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (3) contains a distinct 5' UTR and 5' coding region, and uses an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct and shorter N-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...