KIAA0748 (TESPA1) (NM_001261844) Human Untagged Clone

CAT#: SC332803

TESPA1 (untagged) - Homo sapiens thymocyte expressed, positive selection associated 1 (TESPA1), transcript variant 4



  "NM_001261844" in other vectors (2)

CNY 3710.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal TESPA1 Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSPC257; ITPRID3; KIAA0748
Vector pCMV6-Entry
Sequence Data
>SC332803 representing NM_001261844.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACTGGGGGGACCAACAAGACTAGTTCAAGCATCTCAGAAATTCTGGACAAAGTGCAAGAAGATGCA
GAAGATGTCCTCTTCAGTCTGGGCTTTGGCCAAGAGGATCACAAAGACACTTCTCGGATACCCGCCCGA
TTTTTCACCACCCCCTCTCAGGCCAAGGGCATTGATTTCCAGCTCTTCCTGAAGTCCCAGGTGCGGAGG
ATTGAAATGGAAGACCCCTGCCTCATGCTGGCCAGCAGGTTTAAGCAGGTGCAAACACTGGCTGTCACT
GCTGATGCCTTCTTCTGTCTCTACTCCTATGTGTCTAAGACACCTGTCCAAAAGTTCACACCATCCCAC
ATGTTCTGGAATTGCAACCATCCAACTGATGTGCCATCCATCAGGATTCTGTCCCGAGAGCCTGAACCC
CAGTCACCCAGAGACCGCCTTCGGAAAGCCATCTCCAAGATGTGTCTGTACACATGCCCCCGAGACCGG
CCACCACCACCCCACAACACCCCCAAAAGGAACAGTTTGGACCAAGTTGTGTTGGAAGTGATGGACAAA
GTGAAAGAAGAGAAGCAGTTCCTCCAGCAAGACTCTGATTTGGGGCAATTCTCACAGGAAGATCCTGTG
CCCCCTGCTGAGGGTAAGAAGTTGCCCACTTCTCCCTATCCATGTGTCTTCTGCTGTGAAGAGGAAACA
CAGCAGAGGATGTCCACAGTGCTAGCACCATCCCAAACTCTGGATTCGAACCCCAAGGTACCCTGTTGC
ACACATTCTCTGCCCATAGAAGATCCACAGTGGAGCACAGACCCAGCTCAGATAAGGAGAGAGCTGTGT
AGTCTACCAGCCACCAATACGGAAACCCATCCAGCCAAGGATGAGACTTTCTGGAAAAGAAAGAGCAGA
GCAAGAAAGAGCCTCTTCCAGAAGAATCTCATGGGCAGGAAGGTTAAGTCCTTGGACCTGTCCATCACC
CAGCAGAAATGGAAGCAGAGTGTAGACAGACCAGAACTGCGTCGGTCTTTAAGCCAGCAGCCACAGGAC
ACTTTTGACTTGGAGGAGGTGCAAAGCAACAGTGAGGAGGAGCAGAGTCAGAGTCGCTGGCCCAGCAGA
CCCAGGCACCCCCACCACCACCAGACTTTTGCTGGCAAAGACTCGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001261844
Insert Size 1152 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001261844.1
RefSeq Size 3614 bp
RefSeq ORF 1152 bp
Locus ID 9840
UniProt ID A2RU30
MW 44 kDa
Gene Summary Required for the development and maturation of T-cells, its function being essential for the late stages of thymocyte development (By similarity). Plays a role in T-cell antigen receptor (TCR)-mediated activation of the ERK and NFAT signaling pathways, possibly by serving as a scaffolding protein that promotes the assembly of the LAT signalosome in thymocytes. May play a role in the regulation of inositol 1,4,5-trisphosphate receptor-mediated Ca(2+) release and mitochondrial Ca(2+) uptake via the mitochondria-associated endoplasmic reticulum membrane (MAM) compartment.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4), as well as variants 3 and 5, encodes isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...