GGCT (NM_001199817) Human Untagged Clone

CAT#: SC329571

GGCT (untagged) - Homo sapiens gamma-glutamylcyclotransferase (GGCT), transcript variant 4



  "NM_001199817" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GGCT Antibody - C-terminal region
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C7orf24; CRF21; GCTG; GGC
Vector pCMV6-Entry
Sequence Data
>SC329571 representing NM_001199817.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCAACTCGGGCTGCAAGGACGTCACGGGTCCAGATGAGGAGAGTTTTCTGTACTTTGCCTACGGC
AGCAACCTGCTGACAGAGAGGATCCACCTCCGAAACCCCTCGGCGGCGTTCTTCTGTGTGGCCCGCCTG
CAGATTATTTGCATGGGTGCAAAAGAAAATGGTTTGCCGCTGGAGTATCAAGAGAAGTTAAAAGCAATA
GAACCAAATGACTATACAGGAAAGGTCTCAGAAGAAATTGAAGACATCATCAAAAAGGGGGAAACACAA
ACTCTTTAG

Restriction Sites SgfI-MluI     
ACCN NM_001199817
Insert Size 285 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199817.1
RefSeq Size 915 bp
RefSeq ORF 285 bp
Locus ID 79017
UniProt ID O75223
Protein Pathways Glutathione metabolism
MW 10.5 kDa
Gene Summary The protein encoded by this gene catalyzes the formation of 5-oxoproline from gamma-glutamyl dipeptides, the penultimate step in glutathione catabolism, and may play a critical role in glutathione homeostasis. The encoded protein may also play a role in cell proliferation, and the expression of this gene is a potential marker for cancer. Pseudogenes of this gene are located on the long arm of chromosome 5 and the short arm of chromosomes 2 and 20. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (4) lacks multiple exons in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 4, which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...