NIPA2 (NM_001184888) Human Untagged Clone

CAT#: SC328546

NIPA2 (untagged)-Human non imprinted in Prader-Willi/Angelman syndrome 2 (NIPA2) transcript variant 6



  "NM_001184888" in other vectors (4)

CNY 5510.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-NIPA2 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SLC57A2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328546 representing NM_001184888.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCCAGGGGCGTGGAAAATATGACTTCTATATTGGTCTGGGATTGGCTATGAGCTCCAGCATTTTC
ATTGGAGGAAGTTTCATTTTGAAAAAAAAGGGCCTCCTTCGACTTGCCAGGAAAGGCTCTATGAGAGCA
GTGGGAGCTGGTGAGGTGGCCAACTTCGCTGCGTATGCGTTTGCACCAGCCACTCTAGTGACTCCACTA
GGAGCTCTCAGCGTGCTAGTAAGTGCCATTCTTTCTTCATACTTTCTCAATGAAAGACTTAATCTTCAT
GGGAAAATTGGGTGTTTGCTAAGTATTCTAGGATCTACAGTTATGGTCATTCATGCTCCAAAGGAAGAG
GAGATTGAGACTTTAAATGAAATGTCTCACAAGCTAGGTGATCCAGGTTTTGTGGTCTTTGCAACCCTT
GTGGTCATTGTGGCCTTGATATTAATCTTCGTGGTGGGTCCTCGCCATGGACAGACAAACATTCTTGTG
TACATAACAATCTGCTCTGTAATCGGCGCGTTTTCAGTCTCCTGTGTGAAGGGCCTGGGCATTGCTATC
AAGGAGCTGTTTGCAGGGAAGCCTGTGCTGCGGCATCCCCTGGCTTGGATTCTGCTGCTGAGCCTCATC
GTCTGTGTGAGCACACAGATTAATTACCTAAATAGGGCCCTGGATATATTCAACACTTCCATTGTGACT
CCAATATATTATGTATTCTTTACAACATCAGTTTTAACTTGTTCAGCTATTCTTTTTAAGGAGTGGCAA
GATATGCCTGTTGACGATGTCATTGGTACTTTGAGTGGCTTCTTTACAATCATTGTGGGGATATTCTTG
TTGCATGCCTTTAAAGACGTCAGCTTTAGTCTAGCAAGTCTGCCTGTGTCTTTTCGAAAAGACGAGAAA
GCAATGAATGGCAATCTCTCTAATATGTATGAAGTTCTTAATAATAATGAAGAAAGCTTAACCTGTGGA
ATCGAACAACACACTGGTGAAAATGTCTCCCGAAGAAATGGAAATCTGACAGCTTTTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001184888
Insert Size 1026 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001184888.1
RefSeq Size 3085 bp
RefSeq ORF 1026 bp
Locus ID 81614
UniProt ID Q8N8Q9
Protein Families Transmembrane
MW 37 kDa
Gene Summary This gene encodes a possible magnesium transporter. This gene is located adjacent to the imprinted domain in the Prader-Willi syndrome deletion region of chromosome 15. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 7 and 21.[provided by RefSeq, May 2010]
Transcript Variant: This variant (6) differs in the 5' UTR and lacks an in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Both variants 4 and 6 encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...