TMED5 (NM_001167830) Human Untagged Clone
CAT＃: SC328305
TMED5 (untagged)-Human transmembrane emp24 protein transport domain containing 5 (TMED5) transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CGI-100; p24g2; p28 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC328305 representing NM_001167830.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCGACAAGATCTGGCTGCCCTTCCCCGTGCTCCTTCTGGCCGCTCTGCCTCCGGTGCTGCTGCCT GGGGCGGCCGGCTTCACACCTTCCCTCGATAGCGACTTCACCTTTACCCTTCCCGCCGGCCAGAAGGAG TGCTTCTACCAGCCCATGCCCCTGAAGGCCTCGCTGGAGATCGAGTACCAAGTTTTAGATGGAGCAGGA TTAGATATTGATTTCCATCTTGCCTCTCCAGAAGGCAAAACCTTAGTTTTTGAACAAAGAAAATCAGAT GGAGTTCACACTGTAGAGACTGAAGTTGGTGATTACATGTTCTGCTTTGACAATACATTCAGCACCATT TCTGAGAAGGTGATTTTCTTTGAATTAATCCTGGATAATATGGGAGAACAGGCACAAGAACAAGAAGAT TGGAAGAAATATATTACTGGCACAGATATATTGGATATGAAACTGGAAGACATCCTGGACCCTATTATA AAAATAGCTTCAGATGTGCAAATAAGACTGCATCTTGGAATCCATCAACAGCATCAAGTCCAGACTAAG CAAAAGTGGGCACATACAAACTCTGCTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001167830 |
| Insert Size | 582 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001167830.1 |
| RefSeq Size | 6132 bp |
| RefSeq ORF | 582 bp |
| Locus ID | 50999 |
| UniProt ID | Q9Y3A6 |
| Protein Families | Transmembrane |
| MW | 21.7 kDa |
| Gene Summary | Potential role in vesicular protein trafficking, mainly in the early secretory pathway. Required for the maintenance of the Golgi apparatus; involved in protein exchange between Golgi stacks during assembly. Probably not required for COPI-vesicle-mediated retrograde transport.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) includes an alternate exon that causes a frameshift in the 3' coding region, compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229667 | TMED5 (Myc-DDK-tagged)-Human transmembrane emp24 protein transport domain containing 5 (TMED5), transcript variant 2 |
CNY 2400.00 |
|
| RC229667L3 | Lenti ORF clone of Human transmembrane emp24 protein transport domain containing 5 (TMED5), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC229667L4 | Lenti ORF clone of Human transmembrane emp24 protein transport domain containing 5 (TMED5), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG229667 | TMED5 (tGFP-tagged) - Human transmembrane emp24 protein transport domain containing 5 (TMED5), transcript variant 2 |
CNY 4370.00 |
