CACNB4 (NM_001145798) Human Untagged Clone

CAT#: SC326577

CACNB4 (untagged)-Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 4, mRNA



  "NM_001145798" in other vectors (4)

CNY 7,320.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-CACNB4 Antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAB4; CACNLB4; EA5; EIG9; EJM; EJM4; EJM6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326577 representing NM_001145798.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCTCCTCCTCCTACGCCAAGAACGGGACCGCGGACGGGCCGCACTCCCCCACCTCGCAGGTGGCC
CGAGGCACCACAACCCGGAGGAGCAGGTTGAAAAGATCCGATGGCAGCACCACTTCGACCAGCTTCATC
CTCAGACAGGGTTCAGCGGATTCCTACACAAGCAGGCCGTCTGACTCCGATGTCTCTTTGGAAGAGGAC
CGGGAAGCAATTCGACAGGAGAGAGAACAGCAAGCAGCTATCCAGCTTGAGAGAGCAAAGTCCAAACCT
GTAGCATTTGCCGTGAAGACAAATGTGAGCTACTGCGGCGCCCTGGACGAGGATGTGCCTGTTCCAAGC
ACAGCTATCTCCTTTGATGCTAAAGACTTTCTACATATTAAAGAGAAATATAACAATGATTGGTGGATA
GGAAGGCTGGTGAAAGAGGGCTGTGAAATTGGCTTCATTCCAAGTCCACTCAGATTGGAGAACATACGG
ATCCAGCAAGAACAAAAAAGAGGACGTTTTCACGGAGGGAAATCAAGTGGAAATTCTTCTTCAAGTCTT
GGAGAAATGGTATCTGGGACATTCCGAGCAACTCCCACATCAACAGCAAAACAGAAGCAAAAAGTGACG
GAGCACATTCCTCCTTACGATGTTGTACCGTCAATGCGTCCGGTGGTGTTAGTGGGGCCGTCACTGAAA
GGTTACGAGGTAACAGACATGATGCAGAAAGCCCTCTTTGATTTCCTGAAGCACAGGTTTGATGGGAGG
ATTTCAATAACGAGAGTGACAGCTGACATTTCTCTTGCTAAGAGGTCTGTCCTAAATAATCCCAGCAAG
AGAGCAATAATTGAACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTACAAAGTGAAATTGAAAGAATC
TTTGAGTTGGCAAGATCTTTGCAACTGGTTGTTCTTGATGCAGACACCATCAATCACCCAGCACAACTT
ATAAAGACTTCCTTAGCACCAATTATTGTTCATGTAAAAGTCTCATCTCCAAAGGTTTTACAGCGGTTG
ATTAAATCTAGAGGAAAGTCACAAAGTAAACACTTGAATGTTCAACTGGTGGCAGCTGATAAACTTGCA
CAATGCCCCCCAAGTCAGCGAATGAGGCACAGCAACCACTCCACAGAGAACTCTCCAATTGAAAGACGA
AGTCTAATGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCC
AGTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGGAAGAAGATTACCCTGACTCATACCAGGACACT
TACAAACCCCATAGGAACCGAGGATCACCTGGGGGATATAGCCATGACTCCCGACATAGGCTTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145798
Insert Size 1377 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145798.1
RefSeq Size 7793 bp
RefSeq ORF 1377 bp
Locus ID 785
UniProt ID O00305
Protein Families Druggable Genome, Ion Channels: Other
Protein Pathways Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway
MW 51.3 kDa
Gene Summary This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE), juvenile myoclonic epilepsy (JME), and episodic ataxia, type 5. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (4) lacks an alternate in-frame exon in the 3' coding region, compared to variant 2. The resulting isoform (d) lacks an internal segment near the C-terminus, compared to isoform b. This isoform has a b-type N-terminus. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...