FKBP11 (NM_001143782) Human Untagged Clone
CAT#: SC325515
FKBP11 (untagged)-Human FK506 binding protein 11, 19 kDa (FKBP11), transcript variant 3
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FKBP19 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001143782, the custom clone sequence may differ by one or more nucleotides
ATGACCCTGCGCCCCTCACTCCTCCCGCTCCATCTGCTGCTGCTGCTGCTGCTCAGTGCG GCGGTGTGCCGGGCTGAGGCTGGGCTCGAAACCGAAAGTCCCGTCCGGACCCTCCAAGTG GAGACCCTGGTGGAGCCCCCAGAACCATGTGCCGAGCCCGCTGCTTTTGGAGACACGCTT CACATACACTACACGGGAAGCTTGGTAGATGGACGTATTATTGACACCTCCCTGACCAGA GACCCTCTGGTTATAGAACTTGGCCAAAAGCAGGTGATTCCAGGTCTGGAGCAGAGTCTT CTCGACATGTGTGTGGGAGAGAAGCGAAGGGCAATCATTCCTTCTCACTTGGCCTATGGA AAACGGGGATTTCCACCATCTGTCCCAGGGACTAAAGACAACCTGATGAGGCCACCTGGC ATGACCTCCAGCAGCCAG |
Restriction Sites | Please inquire |
ACCN | NM_001143782 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001143782.1, NP_001137254.1 |
RefSeq Size | 986 bp |
RefSeq ORF | 441 bp |
Locus ID | 51303 |
UniProt ID | Q9NYL4 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | FKBP11 belongs to the FKBP family of peptidyl-prolyl cis/trans isomerases, which catalyze the folding of proline-containing polypeptides. The peptidyl-prolyl isomerase activity of FKBP proteins is inhibited by the immunosuppressant compounds FK506 and rapamycin (Rulten et al., 2006 [PubMed 16596453]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (3) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227523 | FKBP11 (Myc-DDK-tagged)-Human FK506 binding protein 11, 19 kDa (FKBP11), transcript variant 3 |
CNY 3990.00 |
|
RC227523L3 | Lenti-ORF clone of FKBP11 (Myc-DDK-tagged)-Human FK506 binding protein 11, 19 kDa (FKBP11), transcript variant 3 |
CNY 5890.00 |
|
RC227523L4 | Lenti-ORF clone of FKBP11 (mGFP-tagged)-Human FK506 binding protein 11, 19 kDa (FKBP11), transcript variant 3 |
CNY 5890.00 |
|
RG227523 | FKBP11 (tGFP-tagged) - Human FK506 binding protein 11, 19 kDa (FKBP11), transcript variant 3 |
CNY 4370.00 |