AP1AR (NM_001128426) Human Untagged Clone
CAT＃: SC322936
AP1AR (untagged)-Human adaptor-related protein complex 1 associated regulatory protein (AP1AR), transcript variant 2
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2C18; C4orf16; gamma-BAR; GBAR; PRO0971 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC322936 representing NM_001128426.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGAACTGCTGCTGGACGCAGTGCTTCGGACTGCTTCGCAAGGAAGCGGGGCGGCTGCAGCGAGTA GGCGGCGGCGGAGGATCCAAGTATTTTAGAACATGCTCAAGAGGTGAGCACTTAACAATAGAGTTTGAG AATCTAGTAGAAAGTGATGAAGGGGAGAGCCCAGGAAGCAGTCATAGGCCTCTTACTGAGGAAGAAATT GTTGACCTAAGAGAAAGGCATTATGATTCCATTGCCGAAAAACAAAAAGATCTTGATAAGAAAATTCAA AAAGAGCAAGAAAGGCAGAGAATTGTGCAGCAATATCATCCTTCCAACAATGGAGAATATCAAAGTTCA GGACCAGAAGATGACTTCGAATCTTGTTTGAGAAATATGAAGTCACAGTATGAAGTTTTTCGAAGTAGT AGACTCTCATCAGATGCTACAGTTTTGACACCAAATACAGAAAGCAGTTGTGATTTAATGACCAAAACT AAATCAACTAGTGGAAATGACGACAGCACATCCTTAGATCTAGAGTGGGAAGATGAAGAAGGAATGAAT AGAATGCTTCCAATGAGAGAACGTTCCAAAACAGAGGAAGACATTCTACGGGCAGCACTTAAGTATAGC AACAAGAAGACTGGAAGTAATCCTACATCAGCCTCTGATGATTCCAATGGGCTGGAGTGGGAAAATGAT TTTGTTAGTGCCGAAATGGATGATAATGGAAATTCCGAGTATTCTGGATTTGTAAATCCTGTATTAGAA CTGTCTGATTCTGGCATAAGGCATTCTGACACAGATCAACAGACTCGATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001128426 |
| Insert Size | 810 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001128426.2 |
| RefSeq Size | 5878 bp |
| RefSeq ORF | 810 bp |
| Locus ID | 55435 |
| UniProt ID | Q63HQ0 |
| MW | 30.5 kDa |
| Gene Summary | Necessary for adaptor protein complex 1 (AP-1)-dependent transport between the trans-Golgi network and endosomes. Regulates the membrane association of AP1G1/gamma1-adaptin, one of the subunits of the AP-1 adaptor complex. The direct interaction with AP1G1/gamma1-adaptin attenuates the release of the AP-1 complex from membranes. Regulates endosomal membrane traffic via association with AP-1 and KIF5B thus linking kinesin-based plus-end-directed microtubular transport to AP-1-dependent membrane traffic. May act as effector of AP-1 in calcium-induced endo-lysosome secretion. Inhibits Arp2/3 complex function; negatively regulates cell spreading, size and motility via intracellular sequestration of the Arp2/3 complex.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an in-frame exon in the mid-coding region compared to variant 1. The resulting shorter isoform (2) has the same N- and C- termini but lacks an internal protein segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225363 | AP1AR (Myc-DDK-tagged)-Human adaptor-related protein complex 1 associated regulatory protein (AP1AR), transcript variant 2 |
CNY 2400.00 |
|
| RC225363L3 | Lenti ORF clone of Human adaptor-related protein complex 1 associated regulatory protein (AP1AR), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC225363L4 | Lenti ORF clone of Human adaptor-related protein complex 1 associated regulatory protein (AP1AR), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG225363 | AP1AR (tGFP-tagged) - Human adaptor-related protein complex 1 associated regulatory protein (AP1AR), transcript variant 2 |
CNY 4370.00 |
