Placental lactogen (CSH2) (NM_020991) Human Untagged Clone
CAT#: SC320972
CSH2 (untagged)-Human chorionic somatomammotropin hormone 2 (CSH2), transcript variant 1
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CS-2; CSB; GHB1; hCS-B; PL |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_020991.3
AAGCAGGGAGAGAGAACTGGCCAGGGTATAAAAAGGGCCCACAAGAGACCGGCTCTAGGA
TCCCAAGGCCCAACTCCCCGAACCACTCAGGGTCCTGTGGACAGCTCACCTAGTGGCAAT GGCTCCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGCCCTGCTCTGCCTGCCCTGGCT TCAAGAGGCTGGTGCCGTCCAAACCGTTCCGTTATCCAGGCTTTTTGACCACGCTATGCT CCAAGCCCATCGCGCGCACCAGCTGGCCATTGACACCTACCAGGAGTTTGAAGAAACCTA TATCCCAAAGGACCAGAAGTATTCATTCCTGCATGACTCCCAGACCTCCTTCTGCTTCTC AGACTCTATTCCGACACCCTCCAACATGGAGGAAACGCAACAGAAATCCAATCTAGAGCT GCTCCGCATCTCCCTGCTGCTCATCGAGTCGTGGCTGGAGCCCGTGCGGTTCCTCAGGAG TATGTTCGCCAACAACCTGGTGTATGACACCTCGGACAGCGATGACTATCACCTCCTAAA GGACCTAGAGGAAGGCATCCAAACGCTGATGGGGAGGCTGGAAGACGGCAGCCGCCGGAC TGGGCAGATCCTCAAGCAGACCTACAGCAAGTTTGACACAAACTCGCACAACCATGACGC ACTGCTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAAGGTCGAGAC ATTCCTGCGCATGGTGCAGTGCCGCTCTGTGGAGGGCAGCTGTGGCTTCTAGGTGCCCGA GTAGCATCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGAAGGTGCCACTCCAGTGC CCACCAGCCTTGTCCTAATAAAATTAAGTTGTATCATTTAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAATTTAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_020991 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_020991.3, NP_066271.1 |
RefSeq Size | 883 bp |
RefSeq ORF | 654 bp |
Locus ID | 1443 |
UniProt ID | P01243 |
Protein Families | Secreted Protein |
Gene Summary | The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, while the ratio of 1 to 2 increases by term. Structural and expression differences provide avenues for developmental regulation and tissue specificity. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) utilizes all five exons, resulting in the longest, most abundant isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204739 | CSH2 (Myc-DDK-tagged)-Human chorionic somatomammotropin hormone 2 (CSH2), transcript variant 1 |
CNY 3990.00 |
|
RC204739L3 | Lenti-ORF clone of CSH2 (Myc-DDK-tagged)-Human chorionic somatomammotropin hormone 2 (CSH2), transcript variant 1 |
CNY 5890.00 |
|
RC204739L4 | Lenti-ORF clone of CSH2 (mGFP-tagged)-Human chorionic somatomammotropin hormone 2 (CSH2), transcript variant 1 |
CNY 5890.00 |
|
RG204739 | CSH2 (tGFP-tagged) - Human chorionic somatomammotropin hormone 2 (CSH2), transcript variant 1 |
CNY 4370.00 |
|
SC310620 | CSH2 (untagged)-Human chorionic somatomammotropin hormone 2 (CSH2), transcript variant 1 |
CNY 3990.00 |
其它Placental lactogen产品