FUS (NM_004960) Human Untagged Clone
CAT#: SC320263
FUS (untagged)-Human fused in sarcoma (FUS), transcript variant 1
CNY 5888.00
| Cited in 4 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ALS6; altFUS; ETM4; FUS1; HNRNPP2; POMP75; TLS |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_004960.2
CTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTGTGCGCGCGT
GCGCGGACATGGCCTCAAACGATTATACCCAACAAGCAACCCAAAGCTATGGGGCCTACC CCACCCAGCCCGGGCAGGGCTATTCCCAGCAGAGCAGTCAGCCCTACGGACAGCAGAGTT ACAGTGGTTATAGCCAGTCCACGGACACTTCAGGCTATGGCCAGAGCAGCTATTCTTCTT ATGGCCAGAGCCAGAACACAGGCTATGGAACTCAGTCAACTCCCCAGGGATATGGCTCGA CTGGCGGCTATGGCAGTAGCCAGAGCTCCCAATCGTCTTACGGGCAGCAGTCCTCCTATC CTGGCTATGGCCAGCAGCCAGCTCCCAGCAGCACCTCGGGAAGTTACGGTAGCAGTTCTC AGAGCAGCAGCTATGGGCAGCCCCAGAGTGGGAGCTACAGCCAGCAGCCTAGCTATGGTG GACAGCAGCAAAGCTATGGACAGCAGCAAAGCTATAATCCCCCTCAGGGCTATGGACAGC AGAACCAGTACAACAGCAGCAGTGGTGGTGGAGGTGGAGGTGGAGGTGGAGGTAACTATG GCCAAGATCAATCCTCCATGAGTAGTGGTGGTGGCAGTGGTGGCGGTTATGGCAATCAAG ACCAGAGTGGTGGAGGTGGCAGCGGTGGCTATGGACAGCAGGACCGTGGAGGCCGCGGCA GGGGTGGCAGTGGTGGCGGCGGCGGCGGCGGCGGTGGTGGTTACAACCGCAGCAGTGGTG GCTATGAACCCAGAGGTCGTGGAGGTGGCCGTGGAGGCAGAGGTGGCATGGGCGGAAGTG ACCGTGGTGGCTTCAATAAATTTGGTGGCCCTCGGGACCAAGGATCACGTCATGACTCCG AACAGGATAATTCAGACAACAACACCATCTTTGTGCAAGGCCTGGGTGAGAATGTTACAA TTGAGTCTGTGGCTGATTACTTCAAGCAGATTGGTATTATTAAGACAAACAAGAAAACGG GACAGCCCATGATTAATTTGTACACAGACAGGGAAACTGGCAAGCTGAAGGGAGAGGCAA CGGTCTCTTTTGATGACCCACCTTCAGCTAAAGCAGCTATTGACTGGTTTGATGGTAAAG AATTCTCCGGAAATCCTATCAAGGTCTCATTTGCTACTCGCCGGGCAGACTTTAATCGGG GTGGTGGCAATGGTCGTGGAGGCCGAGGGCGAGGAGGACCCATGGGCCGTGGAGGCTATG GAGGTGGTGGCAGTGGTGGTGGTGGCCGAGGAGGATTTCCCAGTGGAGGTGGTGGCGGTG GAGGACAGCAGCGAGCTGGTGACTGGAAGTGTCCTAATCCCACCTGTGAGAATATGAACT TCTCTTGGAGGAATGAATGCAACCAGTGTAAGGCCCCTAAACCAGATGGCCCAGGAGGGG GACCAGGTGGCTCTCACATGGGGGGTAACTACGGGGATGATCGTCGTGGTGGCAGAGGAG GCTATGATCGAGGCGGCTACCGGGGCCGCGGCGGGGACCGTGGAGGCTTCCGAGGGGGCC GGGGTGGTGGGGACAGAGGTGGCTTTGGCCCTGGCAAGATGGATTCCAGGGGTGAGCACA GACAGGATCGCAGGGAGAGGCCGTATTAATTAGCCTGGCTCCCCAGGTTCTGGAACAGCT TTTTGTCCTGTACCCAGTGTTACCCTCGTTATTTTGTAACCTTCCAATTCCTGATCACCC AAGGGTTTTTTTGTGTCGGACTATGTAATTGTAACTATACCTCTGGTTCCCATTAAAAGT GACCATTTTAGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_004960 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004960.2, NP_004951.1 |
| RefSeq Size | 2012 bp |
| RefSeq ORF | 1581 bp |
| Locus ID | 2521 |
| UniProt ID | P35637 |
| Domains | RRM, zf-RanBP |
| Protein Families | Druggable Genome, Stem cell - Pluripotency |
| Gene Summary | This gene encodes a multifunctional protein component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex. The hnRNP complex is involved in pre-mRNA splicing and the export of fully processed mRNA to the cytoplasm. This protein belongs to the FET family of RNA-binding proteins which have been implicated in cellular processes that include regulation of gene expression, maintenance of genomic integrity and mRNA/microRNA processing. Alternative splicing results in multiple transcript variants. Defects in this gene result in amyotrophic lateral sclerosis type 6. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (4)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
FUS-linked essential tremor associated with motor dysfunction in Drosophila
,Tio, M;Wen, R;Lim, YL;Wang, H;Ling, SC;Zhao, Y;Tan, EK;,
Hum. Genet.
,PubMed ID 27395408
[FUS]
|
|
An ALS-associated mutation in the FUS 3'-UTR disrupts a microRNA-FUS regulatory circuitry
,Dini Modigliani, S;Morlando, M;Errichelli, L;Sabatelli, M;Bozzoni, I;,
Nat Commun July 2014
,PubMed ID 25004804
[FUS]
|
|
Roles of long noncoding RNAs in brain development, functional diversification and neurodegenerative diseases
,Wu, P;Zuo, X;Deng, H;Liu, X;Liu, L;Ji, A;,
Brain Res. Bull.
,PubMed ID 23756188
[FUS]
|
|
FUS stimulates microRNA biogenesis by facilitating co-transcriptional Drosha recruitment
,null,
The EMBO Journal
,PubMed ID 23232809
[FUS]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201808 | FUS (Myc-DDK-tagged)-Human fused in sarcoma (FUS), transcript variant 1 |
CNY 3920.00 |
|
| RC201808L1 | Lenti ORF clone of Human fused in sarcoma (FUS), transcript variant 1, Myc-DDK-tagged |
CNY 6320.00 |
|
| RC201808L2 | Lenti ORF clone of Human fused in sarcoma (FUS), transcript variant 1, mGFP tagged |
CNY 6320.00 |
|
| RC201808L3 | Lenti ORF clone of Human fused in sarcoma (FUS), transcript variant 1, Myc-DDK-tagged |
CNY 6320.00 |
|
| RC201808L4 | Lenti ORF clone of Human fused in sarcoma (FUS), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG201808 | FUS (tGFP-tagged) - Human fused in sarcoma (FUS), transcript variant 1 |
CNY 5520.00 |
