p57 Kip2 (CDKN1C) (NM_001122631) Human Untagged Clone

CAT#: SC318825

CDKN1C (untagged)-Human cyclin-dependent kinase inhibitor 1C (p57, Kip2) (CDKN1C), transcript variant 3



  "NM_001122631" in other vectors (2)

CNY 6270.00


货期*
详询

规格
    • 10 ug

Product images

推荐一起购买 (3)
Anti-CDKN1C Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BWCR; BWS; KIP2; p57; p57Kip2; WBS
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001122631, the custom clone sequence may differ by one or more nucleotides
ATGGAGCGTCTTGTCGCCCGTGGGACCTTCCCAGTACTAGTGCGCACCAGCGCCTGCCGC
AGCCTCTTCGGGCCGGTGGACCACGAGGAGCTGAGCCGCGAGCTGCAGGCCCGCCTGGCC
GAGCTGAACGCCGAGGACCAGAACCGCTGGGATTACGACTTCCAGCAGGACATGCCGCTG
CGGGGCCCTGGACGCCTGCAGTGGACCGAAGTGGACAGCGACTCGGTGCCCGCGTTCTAC
CGCGAGACGGTGCAGGTGGGGCGCTGCCGCCTGCTGCTGGCGCCGCGGCCCGTCGCGGTC
GCGGTGGCTGTCAGCCCGCCCCTCGAGCCGGCCGCTGAGTCCCTCGACGGCCTCGAGGAG
GCGCCGGAGCAGCTGCCTAGTGTCCCGGTCCCGGCCCCGGCGTCCACCCCGCCCCCAGTC
CCGGTCCTGGCTCCAGCCCCGGCCCCGGCTCCGGCTCCGGTCGCGGCTCCGGTCGCGGCT
CCGGTCGCGGTCGCGGTCCTGGCCCCGGCCCCGGCCCCGGCTCCGGCTCCGGCTCCGGCC
CCGGCTCCAGTCGCGGCCCCGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCCCGCC
CCGGCCCCGGCCCCGGACGCGGCGCCTCAAGAGAGCGCCGAGCAGGGCGCGAACCAGGGG
CAGCGCGGCCAGGAGCCTCTCGCTGACCAGCTGCACTCGGGGATTTCGGGACGTCCCGCG
GCCGGCACCGCGGCCGCCAGCGCCAACGGCGCGGCGATCAAGAAGCTGTCCGGGCCTCTG
ATCTCCGATTTCTTCGCCAAGCGCAAGAGATCAGCGCCTGAGAAGTCGTCGGGCGATGTC
CCCGCGCCGTGTCCCTCTCCAAGCGCCGCCCCTGGCGTGGGCTCGGTGGAGCAGACCCCG
CGCAAGAGGCTGCGG
Restriction Sites Please inquire     
ACCN NM_001122631
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001122631.1, NP_001116103.1
RefSeq Size 1771 bp
RefSeq ORF 918 bp
Locus ID 1028
UniProt ID P49918
Protein Families Druggable Genome
Protein Pathways Cell cycle
Gene Summary This gene is imprinted, with preferential expression of the maternal allele. The encoded protein is a tight-binding, strong inhibitor of several G1 cyclin/Cdk complexes and a negative regulator of cell proliferation. Mutations in this gene are implicated in sporadic cancers and Beckwith-Wiedemann syndorome, suggesting that this gene is a tumor suppressor candidate. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence and uses an alternate splice junction in the 3' UTR compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2 and 3 both encode isoform b.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...