United States
Germany
Japan
United Kingdom
China
SFRS5 (SRSF5) (NM_006925) Human Untagged Clone
CAT＃: SC317393
SRSF5 (untagged)-Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HRS; SFRS5; SRP40 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC317393 representing NM_006925.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTGGCTGTCGGGTATTCATCGGGAGACTAAATCCAGCGGCCAGGGAGAAGGACGTGGAAAGATTC TTCAAGGGATATGGACGGATAAGAGATATTGATCTGAAAAGAGGCTTTGGTTTTGTGGAATTTGAGGAT CCAAGGGATGCAGATGATGCTGTGTATGAGCTTGATGGAAAAGAACTCTGTAGTGAAAGGGTTACTATT GAACATGCTAGGGCTCGGTCACGAGGTGGAAGAGGTAGAGGACGATACTCTGACCGTTTTAGTAGTCGC AGACCTCGAAATGATAGACGAAATGCTCCACCTGTAAGAACAGAAAATCGTCTTATAGTTGAGAATTTA TCCTCAAGAGTCAGCTGGCAGGATCTCAAAGATTTCATGAGACAAGCTGGGGAAGTAACGTTTGCGGAT GCACACCGACCTAAATTAAATGAAGGGGTGGTTGAGTTTGCCTCTTATGGTGACTTAAAGAATGCTATT GAAAAACTTTCTGGAAAGGAAATAAATGGGAGAAAAATAAAATTAATTGAAGGCAGCAAAAGGCACAGT AGGTCAAGAAGCAGGTCTCGATCCCGGACCAGAAGTTCCTCTAGGTCTCGTAGCCGATCCCGTTCCCGT AGTCGCAAATCTTACAGCCGGTCAAGAAGCAGGAGCAGGAGCCGGAGCCGGAGCAAGTCCCGTTCTGTT AGTAGGTCTCCCGTGCCTGAGAAGAGCCAGAAACGTGGTTCTTCAAGTAGATCTAAGTCTCCAGCATCT GTGGATCGCCAGAGGTCCCGGTCCCGATCAAGGTCCAGATCAGTTGACAGTGGCAATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_006925 |
| Insert Size | 819 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_006925.4 |
| RefSeq Size | 1547 bp |
| RefSeq ORF | 819 bp |
| Locus ID | 6430 |
| UniProt ID | Q13243 |
| Protein Pathways | Spliceosome |
| MW | 31.3 kDa |
| Gene Summary | The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218652 | SRSF5 (Myc-DDK-tagged)-Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2 |
CNY 2,400.00 |
|
| RC218652L1 | Lenti ORF clone of Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC218652L2 | Lenti ORF clone of Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC218652L3 | Lenti ORF clone of Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC218652L4 | Lenti ORF clone of Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG218652 | SRSF5 (tGFP-tagged) - Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2 |
CNY 4,000.00 |
|
| SC127158 | SRSF5 (untagged)-Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2 |
CNY 1,200.00 |
