SFRS5 (SRSF5) (NM_006925) Human Untagged Clone
CAT#: SC127158
SRSF5 (untagged)-Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2
CNY 1200.00
CNY 6270.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HRS; SFRS5; SRP40 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_006925, the custom clone sequence may differ by one or more nucleotides
ATGAGTGGCTGTCGGGTATTCATCGGGAGACTAAATCCAGCGGCCAGGGAGAAGGACGTGGAAAGATTCT TCAAGGGATATGGACGGATAAGAGATATTGATCTGAAAAGAGGCTTTGGTTTTGTGGAATTTGAGGATCC AAGGGATGCAGATGATGCTGTGTATGAGCTTGATGGAAAAGAACTCTGTAGTGAAAGGGTTACTATTGAA CATGCTAGGGCTCGGTCACGAGGTGGAAGAGGTAGAGGACGATACTCTGACCGTTTTAGTAGTCGCAGAC CTCGAAATGATAGACGAAATGCTCCACCTGTAAGAACAGAAAATCGTCTTATAGTTGAGAATTTATCCTC AAGAGTCAGCTGGCAGGATCTCAAAGATTTCATGAGACAAGCTGGGGAAGTAACGTTTGCGGATGCACAC CGACCTAAATTAAATGAAGGGGTGGTTGAGTTTGCCTCTTATGGTGACTTAAAGAATGCTATTGAAAAAC TTTCTGGAAAGGAAATAAATGGGAGAAAAATAAAATTAATTGAAGGCAGCAAAAGGCACAGTAGGTCAAG AAGCAGGTCTCGATCCCGGACCAGAAGTTCCTCTAGGTCTCGTAGCCGATCCCGTTCCCGTAGTCGCAAA TCTTACAGCCGGTCAAGAAGCAGGAGCAGGAGCCGGAGCCGGAGCAAGTCCCGTTCTGTTAGTAGGTCTC CCGTGCCTGAGAAGAGCCAGAAACGTGGTTCTTCAAGTAGATCTAAGTCTCCAGCATCTGTGGATCGCCA GAGGTCCCGGTCCCGATCAAGGTCCAGATCAGTTGACAGTGGCAATTAA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_006925 |
| Insert Size | 1600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | A TrueClone. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_006925.2, NP_008856.1 |
| RefSeq Size | 1517 bp |
| RefSeq ORF | 324 bp |
| Locus ID | 6430 |
| UniProt ID | Q13243 |
| Protein Pathways | Spliceosome |
| Gene Summary | The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Spliceosome Protein (SRp) Regulation of Glucocorticoid Receptor Isoforms and Glucocorticoid Response in Human Trabecular Meshwork Cells
,Ankur Jain, Robert J. Wordinger, Thomas Yorio, and Abbot F. Clark,
Invest. Ophthalmol. Vis. Sci., Feb 2012; 53: 857 - 866.
[SRSF5]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218652 | SRSF5 (Myc-DDK-tagged)-Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2 |
CNY 2400.00 |
|
| RC218652L1 | Lenti ORF clone of Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC218652L2 | Lenti ORF clone of Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RC218652L3 | Lenti ORF clone of Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC218652L4 | Lenti ORF clone of Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG218652 | SRSF5 (tGFP-tagged) - Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2 |
CNY 4000.00 |
|
| SC317393 | SRSF5 (untagged)-Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2 |
CNY 6270.00 |
