RGS20 (NM_003702) Human Untagged Clone
CAT#: SC317344
RGS20 (untagged)-Human regulator of G-protein signaling 20 (RGS20), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | g(z)GAP; gz-GAP; RGSZ1; ZGAP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317344 representing NM_003702.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCGCACGGCGGACGGAGGCGAGCCGGCCGGGGCTTCCTCCCCGGCCGGCAGGGTGGACGGTGGGCTC CAGATGGGATCAGAGCGGATGGAGATGCGGAAGCGGCAGATGCCCGCCGCCCAGGACACACCAGGCGCC GCCCCAGGCCAGCCCGGAGCGGGGAGTCGCGGGTCCAACGCATGCTGCTTCTGCTGGTGCTGCTGTTGT AGCTGCTCGTGTCTCACTGTTAGAAACCAGGAAGATCAGAGGCCCACAATAGCTTCCCACGAACTCAGA GCAGATCTTCCAACCTGGGAAGAAAGCCCTGCTCCTACTCTGGAAGAAGTCAACGCCTGGGCTCAGTCA TTTGACAAATTAATGGTCACTCCAGCAGGAAGGAATGCATTCCGTGAATTCCTCCGAACAGAATTCAGT GAGGAAAATATGCTCTTCTGGATGGCCTGTGAGGAACTGAAAAAGGAAGCTAATAAAAACATTATTGAA GAGAAAGCAAGGATAATCTATGAAGACTACATTTCTATACTTTCTCCTAAGGAGGTGAGCTTAGACTCC CGGGTGAGAGAAGTGATCAACAGAAACATGGTGGAGCCATCCCAACACATATTCGATGATGCTCAACTT CAGATTTACACCCTGATGCACAGAGACTCATATCCTCGATTCATGAACTCTGCTGTCTATAAGGACTTG CTTCAGTCCTTATCGGAGAAATCTATTGAAGCATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_003702 |
Insert Size | 726 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_003702.4 |
RefSeq Size | 1716 bp |
RefSeq ORF | 726 bp |
Locus ID | 8601 |
UniProt ID | O76081 |
Domains | RGS |
Protein Families | Druggable Genome |
MW | 27.1 kDa |
Gene Summary | The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region compared to variant 1. The resulting isoform (b) has a shorter and distinct N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209495 | RGS20 (Myc-DDK-tagged)-Human regulator of G-protein signaling 20 (RGS20), transcript variant 2 |
CNY 2400.00 |
|
RC209495L3 | Lenti ORF clone of Human regulator of G-protein signaling 20 (RGS20), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC209495L4 | Lenti ORF clone of Human regulator of G-protein signaling 20 (RGS20), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG209495 | RGS20 (tGFP-tagged) - Human regulator of G-protein signaling 20 (RGS20), transcript variant 2 |
CNY 4000.00 |
|
SC117814 | RGS20 (untagged)-Human regulator of G-protein signaling 20 (RGS20), transcript variant 2 |
CNY 2400.00 |