United States
Germany
Japan
United Kingdom
China
SKA2 (NM_001100595) Human Untagged Clone
CAT＃: SC316631
SKA2 (untagged)-Human spindle and kinetochore associated complex subunit 2 (SKA2), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FAM33A |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC316631 representing NM_001100595.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCTCGGAGGTGGGGCACAATTTGGAGTCGCCGGAAACTCCGGGCGGCGGAGGCTGGACCAGAGTC GAGTTCCCTCCTCCTGCACCAAAGGGAGCCGCCACCGTCTGGTGTCTAAACCGCCTCGGTTCCAGAAAG CTGAGTCTGATCTGGATTACATTCAATACAGGCTGGAATATGAAATCAAGACTAATCATCCTGATTCAG CAAGTGAGCTGTCACCACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001100595 |
| Insert Size | 228 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001100595.1 |
| RefSeq Size | 2988 bp |
| RefSeq ORF | 228 bp |
| Locus ID | 348235 |
| UniProt ID | Q8WVK7 |
| MW | 8.3 kDa |
| Gene Summary | Component of the SKA1 complex, a microtubule-binding subcomplex of the outer kinetochore that is essential for proper chromosome segregation (PubMed:17093495, PubMed:19289083, PubMed:23085020). Required for timely anaphase onset during mitosis, when chromosomes undergo bipolar attachment on spindle microtubules leading to silencing of the spindle checkpoint (PubMed:17093495). The SKA1 complex is a direct component of the kinetochore-microtubule interface and directly associates with microtubules as oligomeric assemblies (PubMed:19289083). The complex facilitates the processive movement of microspheres along a microtubule in a depolymerization-coupled manner (PubMed:17093495, PubMed:19289083). In the complex, it is required for SKA1 localization (PubMed:19289083). Affinity for microtubules is synergistically enhanced in the presence of the ndc-80 complex and may allow the ndc-80 complex to track depolymerizing microtubules (PubMed:23085020).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) has multiple differences in the coding region, compared to variant 1, one of which results in a translational frameshift. The resulting protein (isoform 2) has a distinct C-terminus and is shorter than isoform 1. The biological validity of the predicted protein sequence needs to be experimentally verified. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222296 | SKA2 (Myc-DDK-tagged)-Human spindle and kinetochore associated complex subunit 2 (SKA2), transcript variant 2 |
CNY 1,200.00 |
|
| RC222296L3 | Lenti ORF clone of Human spindle and kinetochore associated complex subunit 2 (SKA2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC222296L4 | Lenti ORF clone of Human spindle and kinetochore associated complex subunit 2 (SKA2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG222296 | SKA2 (tGFP-tagged) - Human spindle and kinetochore associated complex subunit 2 (SKA2), transcript variant 2 |
CNY 4,370.00 |
