MXI1 (NM_005962) Human Untagged Clone
CAT#: SC312545
MXI1 (untagged)-Human MAX interactor 1 (MXI1), transcript variant 1
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHc11; MAD2; MXD2; MXI |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_005962 edited
ATGGAGCGGGTGAAGATGATCAACGTGCAGCGTCTGCTGGAGGCTGCCGAGTTTTTGGAG CGCCGGGAGCGAGAGTGTGAACATGGCTACGCCTCTTCATTCCCGTCCATGCCGAGCCCC CGACTGCAGCATTCAAAGCCCCCACGGAGGTTGAGCCGGGCACAGAAACACAGCAGCGGG AGCAGCAACACCAGCACTGCCAACAGATCTACACACAATGAGCTGGAAAAGAATCGACGA GCTCATCTGCGCCTTTGTTTAGAACGCTTAAAAGTTCTGATTCCACTAGGACCAGACTGC ACCCGGCACACAACACTTGGTTTGCTCAACAAAGCCAAAGCACACATCAAGAAACTTGAA GAAGCTGAAAGAAAAAGCCAGCACCAGCTCGAGAATTTGGAACGAGAACAGAGATTTTTA AAGTGGCGACTGGAACAGCTGCAGGGTCCTCAGGAGATGGAACGAATACGAATGGACAGC ATTGGATCAACTATTTCTTCAGATCGTTCTGATTCAGAGCGAGAGGAGATTGAAGTGGAT GTTGAAAGCACAGAGTTCTCCCATGGAGAAGTGGACAATATAAGTACCACCAGCATCAGT GACATTGATGACCACAGCAGCCTGCCGAGTATTGGGAGTGACGAGGGTTACTCCAGTGCC AGTGTCAAACTTTCATTCACTTCATAG |
Restriction Sites | Please inquire |
ACCN | NM_005962 |
Insert Size | 2400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005962.4. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005962.4, NP_005953.4 |
RefSeq Size | 3272 bp |
RefSeq ORF | 687 bp |
Locus ID | 4601 |
UniProt ID | P50539 |
Domains | HLH |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | Expression of the c-myc gene, which produces an oncogenic transcription factor, is tightly regulated in normal cells but is frequently deregulated in human cancers. The protein encoded by this gene is a transcriptional repressor thought to negatively regulate MYC function, and is therefore a potential tumor suppressor. This protein inhibits the transcriptional activity of MYC by competing for MAX, another basic helix-loop-helix protein that binds to MYC and is required for its function. Defects in this gene are frequently found in patients with prostate tumors. Three alternatively spliced transcripts encoding different isoforms have been described. Additional alternatively spliced transcripts may exist but the products of these transcripts have not been verified experimentally. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1), also referred to as SRbeta, encodes the predominant isoform (a). CCDS Note: The coding region has been updated to include an alternative exon that is more supported by the available transcript and protein data. The update completes the helix-loop-helix dimerization domain, which was previously truncated. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212437 | MXI1 (Myc-DDK-tagged)-Human MAX interactor 1 (MXI1), transcript variant 1 |
CNY 3990.00 |
|
RC212437L3 | Lenti-ORF clone of MXI1 (Myc-DDK-tagged)-Human MAX interactor 1 (MXI1), transcript variant 1 |
CNY 5890.00 |
|
RC212437L4 | Lenti-ORF clone of MXI1 (mGFP-tagged)-Human MAX interactor 1 (MXI1), transcript variant 1 |
CNY 5890.00 |
|
RG212437 | MXI1 (tGFP-tagged) - Human MAX interactor 1 (MXI1), transcript variant 1 |
CNY 4370.00 |