APAF1 (NM_181869) Human Untagged Clone

CAT#: SC309446

APAF1 (untagged)-Human apoptotic peptidase activating factor 1 (APAF1), transcript variant 5



  "NM_181869" in other vectors (6)

CNY 5510.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-APAF1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APAF-1; CED4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_181869, the custom clone sequence may differ by one or more nucleotides
ATGGATGCAAAAGCTCGAAATTGTTTGCTTCAACATAGAGAAGCTCTGGAAAAGGACATC
AAGACATCCTACATCATGGATCACATGATTAGTGATGGATTTTTAACAATATCAGAAGAG
GAAAAAGTAAGAAATGAGCCCACTCAACAGCAAAGAGCAGCTATGCTGATTAAAATGATA
CTTAAAAAAGATAATGATTCCTACGTATCATTCTACAATGCTCTACTACATGAAGGATAT
AAAGATCTTGCTGCCCTTCTCCATGATGGCATTCCTGTTGTCTCTTCTTCCAGTGGTAAA
GATTCAGTTAGTGGAATAACTTCGTATGTAAGGACAGTCCTGTGTGAAGGTGGAGTACCA
CAGAGGCCAGTTGTTTTTGTCACAAGGAAGAAGCTGGTGAATGCAATTCAGCAGAAGCTC
TCCAAATTGAAAGGTGAACCAGGATGGGTCACCATACATGGAATGGCAGGCTGTGGGAAG
TCTGTATTAGCTGCAGAAGCTGTTAGAGATCATTCCCTTTTAGAAGGTTGTTTCCCAGGG
GGAGTGCATTGGGTTTCAGTTGGGAAACAAGACAAATCTGGGCTTCTGATGAAACTGCAG
AATCTTTGCACACGGTTGGATCAGGATGAGAGTTTTTCCCAGAGGCTTCCACTTAATATT
GAAGAGGCTAAAGACCGTCTCCGCATTCTGATGCTTCGCAAACACCCAAGGTCTCTCTTG
ATCTTGGATGATGTTTGGGACTCTTGGGTGTTGAAAGCTTTTGACAGTCAGTGTCAGATT
CTTCTTACAACCAGAGACAAGAGTGTTACAGATTCAGTAATGGGTCCTAAATATGTAGTC
CCTGTGGAGAGTTCCTTAGGAAAGGAAAAAGGACTTGAAATTTTATCCCTTTTTGTTAAT
ATGAAGAAGGCAGATTTGCCAGAACAAGCTCATAGTATTATAAAAGAATGTAAAGTGGTG
GAACGTTGTCACTGGGGAATCCTCACAGACCTTCTACACAAATGGAACCAATCTTAA
Restriction Sites Please inquire     
ACCN NM_181869
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_181869.1, NP_863659.1
RefSeq Size 4559 bp
RefSeq ORF 1017 bp
Locus ID 317
UniProt ID O14727
Protein Families Druggable Genome
Protein Pathways Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Apoptosis, Huntington's disease, p53 signaling pathway, Parkinson's disease, Small cell lung cancer
Gene Summary This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (5), also known as APAF-1-ALT, lacks several exons in the coding sequence, resulting in a frameshift and an early termination codon compared to variant 3. Variant 5 encodes isoform e, which is shorter and has a distinct C-terminus compared to isoform c.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...