GPR141 (NM_181791) Human Untagged Clone

CAT#: SC307369

GPR141 (untagged)-Human G protein-coupled receptor 141 (GPR141)



  "NM_181791" in other vectors (4)

CNY 2400.00

CNY 6270.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-GPR141 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PGR13
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_181791 edited
ATGCCTGGCCACAATACCTCCAGGAATTCCTCTTGCGATCCTATAGTGACACCCCACTTA
ATCAGCCTCTACTTCATAGTGCTTATTGGCGGGCTGGTGGGTGTCATTTCCATTCTTTTC
CTCCTGGTGAAAATGAACACCCGGTCAGTGACCACCATGGCGGTCATTAACTTGGTGGTG
GTCCACAGCGTTTTTCTGCTGACAGTGCCATTTCGCTTGACCTACCTCATCAAGAAGACT
TGGATGTTTGGGCTGCCCTTCTGCAAATTTGTGAGTGCCATGCTGCACATCCACATGTAC
CTCACGTTCCTATTCTATGTGGTGATCCTGGTCACCAGATACCTCATCTTCTTCAAGTGC
AAAGACAAAGTGGAATTCTACAGAAAACTGCATGCTGTGGCTGCCAGTGCTGGCATGTGG
ACGCTGGTGATTGTCATTGTGGTACCCCTGGTTGTCTCCCGGTATGGAATCCATGAGGAA
TACAATGAGGAGCACTGTTTTAAATTTCACAAAGAGCTTGCTTACACATATGTGAAAATC
ATCAACTATATGATAGTCATTTTTGTCATAGCCGTTGCTGTGATTCTGTTGGTCTTCCAG
GTCTTCATCATTATGTTGATGGTGCAGAAGCTACGCCACTCTTTACTATCCCACCAGGAG
TTCTGGGCTCAGCTGAAAAACCTATTTTTTATAGGGGTCATCCTTGTTTGTTTCCTTCCC
TACCAGTTCTTTAGGATCTATTACTTGAATGTTGTGACGCATTCCAATGCCTGTAACAGC
AAGGTTGCATTTTATAACGAAATCTTCTTGAGTGTAACAGCAATTAGCTGCTATGATTTG
CTTCTCTTTGTCTTTGGGGGAAGCCATTGGTTTAAGCAAAAGATAATTGGCTTATGGAAT
TGTGTTTTGTGCCGTTAG
Restriction Sites Please inquire     
ACCN NM_181791
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_181791.1, NP_861456.1
RefSeq Size 918 bp
RefSeq ORF 918 bp
Locus ID 353345
UniProt ID Q7Z602
Protein Families Druggable Genome, Transmembrane
Gene Summary GPR141 is a member of the rhodopsin family of G protein-coupled receptors (GPRs) (Fredriksson et al., 2003 [PubMed 14623098]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (1) and variants 2 and 3 all encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...