U1SNRNPBP (SNRNP35) (NM_180703) Human Untagged Clone
CAT#: SC307239
SNRNP35 (untagged)-Human small nuclear ribonucleoprotein 35kDa (U11/U12) (SNRNP35), transcript variant 4
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HM-1; MGC138160; small nuclear ribonucleoprotein 35kDa (U11/U12); U1 snRNP binding protein homolog; U1-snRNP binding protein homolog; U1SNRNPBP; U11/U12 snRNP 35K |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307239 representing NM_180703.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAACCAGCTAACATGAACGATTGGATGCCCATCGCCAAGGAGTATGATCCACTCAAAGCGGGCAGC ATTGATGGCACCGATGAAGACCCACACGACCGCGCGGTCTGGAGGGCAATGCTGGCACGATATGTCCCC AACAAAGGTGTCATAGGAGATCCCCTCCTCACCCTGTTTGTGGCCAGACTAAACTTGCAGACCAAGGAG GACAAATTAAAGGAAGTCTTTTCCCGCTATGGTGACATCCGGCGGCTTCGGCTGGTCAGGGACTTGGTC ACAGGTTTTTCAAAGGGCTACGCCTTCATCGAATACAAGGAGGAGCGTGCCGTGATCAAAGCTTACCGA GATGCTGATGGCCTGGTTATTGACCAGCATGAGATATTTGTGGACTACGAGCTGGAAAGGACTCTCAAA GGGTGGATCCCTCGGCGACTTGGAGGCGGTCTTGGGGGAAAAAAGGAGTCTGGGCAACTGAGATTTGGG GGACGGGACCGGCCTTTTCGAAAACCTATTAACTTGCCAGTTGTTAAAAACGACCTCTATAGAGAGGGA AAACGGGAAAGGCGGGAGCGATCTCGATCCCGAGAAAGACACTGGGACTCGAGGACAAGGGATCGAGAC CATGACAGGGGCCGGGAGAAGAGATGGCAAGAAAGAGAGCCGACCAGGGTGTGGCCCGACAATGACTGG GAGAGAGAGAGGGACTTCAGAGATGACAGGATCAAGGGGAGGGAGAAGAAGGAAAGAGGCAAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_180703 |
Insert Size | 756 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_180703.2 |
RefSeq Size | 1523 bp |
RefSeq ORF | 756 bp |
Locus ID | 11066 |
MW | 30 kDa |
Gene Summary | The protein encoded by this gene is a homolog of the U1-snRNP binding protein. The N-terminal half contains a RNA recognition motif and the C-terminal half is rich in Arg/Asp and Arg/Glu dipeptides, which is a characteristic of a variety of splicing factors. This protein is a component of the U11/U12 small nuclear ribonucleoproteins (snRNP) that form part of the U12-type spliceosome. Alternative splicing results in multiple transcript variants encoding two distinct isoforms and representing a non-protein coding variant. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (4) lacks a segment in the 5' UTR, and contains the same ribosomal binding site in the 5' coding region, as compared to variant 3. Both variants 3 and 4 encodes isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219410 | SNRNP35 (Myc-DDK-tagged)-Human small nuclear ribonucleoprotein 35kDa (U11/U12) (SNRNP35), transcript variant 4 |
CNY 2400.00 |
|
RC219410L3 | Lenti ORF clone of Human small nuclear ribonucleoprotein 35kDa (U11/U12) (SNRNP35), transcript variant 4, Myc-DDK-tagged |
CNY 5890.00 |
|
RC219410L4 | Lenti ORF clone of Human small nuclear ribonucleoprotein 35kDa (U11/U12) (SNRNP35), transcript variant 4, mGFP tagged |
CNY 5890.00 |
|
RG219410 | SNRNP35 (tGFP-tagged) - Human small nuclear ribonucleoprotein 35kDa (U11/U12) (SNRNP35), transcript variant 4 |
CNY 4370.00 |
其它U1SNRNPBP产品