IL28B (IFNL3) (NM_172139) Human Untagged Clone
CAT#: SC306726
IFNL3 (untagged)-Human interleukin 28B (interferon, lambda 3) (IL28B)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IFN-lambda-3; IFN-lambda-4; IL-28B; IL-28C; IL28B; IL28C |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>SC306726 representing NM_172139.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGACCGGGGACTGCATGCCAGTGCTGGTGCTGATGGCCGCAGTGCTGACCGTGACTGGAGCAGTTCCT GTCGCCAGGCTCCGCGGGGCTCTCCCGGATGCAAGGGGCTGCCACATAGCCCAGTTCAAGTCCCTGTCT CCACAGGAGCTGCAGGCCTTTAAGAGGGCCAAAGATGCCTTAGAAGAGTCGCTTCTGCTGAAGGACTGC AAGTGCCGCTCCCGCCTCTTCCCCAGGACCTGGGACCTGAGGCAGCTGCAGGTGAGGGAGCGCCCCGTG GCTTTGGAGGCTGAGCTGGCCCTGACGCTGAAGGTTCTGGAGGCCACCGCTGACACTGACCCAGCCCTG GGGGATGTCTTGGACCAGCCCCTTCACACCCTGCACCATATCCTCTCCCAGCTCCGGGCCTGTATCCAG CCTCAGCCCACGGCAGGGCCCAGGACCCGGGGCCGCCTCCACCATTGGCTGCACCGGCTCCAGGAGGCC CCAAAAAAGGAGTCCCCTGGCTGCCTCGAGGCCTCTGTCACCTTCAACCTCTTCCGCCTCCTCACGCGA GACCTGAATTGTGTTGCCAGCGGGGACCTGTGTGTCTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_172139 |
| Insert Size | 591 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_172139.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_172139.2 |
| RefSeq Size | 595 bp |
| RefSeq ORF | 591 bp |
| Locus ID | 282617 |
| UniProt ID | Q8IZI9 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
| MW | 21.7 kDa |
| Gene Summary | This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28A (IL28A), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA). [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate 5' terminal exon resulting in a novel 5' UTR, and the use of a downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus, and contains a signal peptide, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218965 | IFNL3 (Myc-DDK-tagged)-Human interleukin 28B (interferon, lambda 3) (IL28B) |
CNY 2400.00 |
|
| RC218965L3 | Lenti ORF clone of Human interleukin 28B (interferon, lambda 3) (IL28B), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC218965L4 | Lenti ORF clone of Human interleukin 28B (interferon, lambda 3) (IL28B), mGFP tagged |
CNY 5890.00 |
|
| RG218965 | IFNL3 (tGFP-tagged) - Human interleukin 28B (interferon, lambda 3) (IL28B) |
CNY 4370.00 |
