STARD6 (NM_139171) Human Untagged Clone
CAT＃: SC306127
STARD6 (untagged)-Human StAR-related lipid transfer (START) domain containing 6 (STARD6)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC306127 representing NM_139171.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACTTCAAGGCAATTGCCCAACAAACTGCCCAAGAAGTTTTAGGTTATAATCGAGATACATCAGGC TGGAAAGTGGTTAAAACTTCAAAAAAGATAACTGTTTCCAGTAAGGCTTCTAGAAAATTCCATGGAAAT CTATATCGTGTTGAAGGGATAATTCCAGAATCACCAGCTAAACTATCTGATTTCCTCTACCAAACTGGA GACAGAATTACATGGGATAAATCATTGCAAGTGTATAATATGGTACACAGGATTGATTCGGACACATTC ATATGTCATACCATTACACAAAGTTTTGCCGTGGGCTCCATTTCCCCTCGAGACTTTATCGACTTAGTG TACATCAAGCGCTACGAAGGAAATATGAACATTATCAGTTCTAAAAGTGTGGATTTTCCAGAATATCCT CCATCTTCAAATTATATCCGCGGTTATAACCATCCTTGTGGCTTTGTATGTTCACCAATGGAAGAAAAC CCAGCATATTCCAAACTAGTGATGTTTGTCCAGACAGAAATGAGAGGAAAATTGTCCCCATCAATAATT GAAAAAACCATGCCTTCCAACTTAGTAAACTTCATCCTCAATGCAAAAGATGGAATAAAGGCACACAGA ACTCCATCAAGACGTGGATTTCATCATAATAGTCATTCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_139171 |
| Insert Size | 663 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_139171.1 |
| RefSeq Size | 663 bp |
| RefSeq ORF | 663 bp |
| Locus ID | 147323 |
| UniProt ID | P59095 |
| MW | 25 kDa |
| Gene Summary | Cholesterol homeostasis is regulated, at least in part, by sterol regulatory element (SRE)-binding proteins (e.g., SREBP1; MIM 184756) and by liver X receptors (e.g., LXRA; MIM 602423). Upon sterol depletion, LXRs are inactive and SREBPs are cleaved, after which they bind promoter SREs and activate genes involved in cholesterol biosynthesis and uptake. Sterol transport is mediated by vesicles or by soluble protein carriers, such as steroidogenic acute regulatory protein (STAR; MIM 600617). STAR is homologous to a family of proteins containing a 200- to 210-amino acid STAR-related lipid transfer (START) domain, including STARD6 (Soccio et al., 2002 [PubMed 12011452]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (1) represents the longer, protein-coding transcript. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223175 | STARD6 (Myc-DDK-tagged)-Human StAR-related lipid transfer (START) domain containing 6 (STARD6) |
CNY 2400.00 |
|
| RC223175L1 | Lenti ORF clone of Human StAR-related lipid transfer (START) domain containing 6 (STARD6), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC223175L2 | Lenti ORF clone of Human StAR-related lipid transfer (START) domain containing 6 (STARD6), mGFP tagged |
CNY 5890.00 |
|
| RC223175L3 | Lenti ORF clone of Human StAR-related lipid transfer (START) domain containing 6 (STARD6), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC223175L4 | Lenti ORF clone of Human StAR-related lipid transfer (START) domain containing 6 (STARD6), mGFP tagged |
CNY 5890.00 |
|
| RG223175 | STARD6 (tGFP-tagged) - Human StAR-related lipid transfer (START) domain containing 6 (STARD6) |
CNY 4370.00 |
