FCN3 (NM_003665) Human Untagged Clone

CAT#: SC303361

FCN3 (untagged)-Human ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen) (FCN3), transcript variant 1



  "NM_003665" in other vectors (6)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-FCN3 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FCNH; HAKA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303361 representing NM_003665.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATCTACTGTGGATCCTGCCCTCCCTGTGGCTTCTCCTGCTTGGGGGGCCTGCCTGCCTGAAGACC
CAGGAACACCCCAGCTGCCCAGGACCCAGGGAACTGGAAGCCAGCAAAGTTGTCCTCCTGCCCAGTTGT
CCCGGAGCTCCAGGAAGTCCTGGGGAGAAGGGAGCCCCAGGTCCTCAAGGGCCACCTGGACCACCAGGC
AAGATGGGCCCCAAGGGTGAGCCAGGAGATCCAGTGAACCTGCTCCGGTGCCAGGAAGGCCCCAGAAAC
TGCCGGGAGCTGTTGAGCCAGGGCGCCACCTTGAGCGGCTGGTACCATCTGTGCCTACCTGAGGGCAGG
GCCCTCCCAGTCTTTTGTGACATGGACACCGAGGGGGGCGGCTGGCTGGTGTTTCAGAGGCGCCAGGAT
GGTTCTGTGGATTTCTTCCGCTCTTGGTCCTCCTACAGAGCAGGTTTTGGGAACCAAGAGTCTGAATTC
TGGCTGGGAAATGAGAATTTGCACCAGCTTACTCTCCAGGGTAACTGGGAGCTGCGGGTAGAGCTGGAA
GACTTTAATGGTAACCGTACTTTCGCCCACTATGCGACCTTCCGCCTCCTCGGTGAGGTAGACCACTAC
CAGCTGGCACTGGGCAAGTTCTCAGAGGGCACTGCAGGGGATTCCCTGAGCCTCCACAGTGGGAGGCCC
TTTACCACCTATGACGCTGACCACGATTCAAGCAACAGCAACTGTGCAGTGATTGTCCACGGTGCCTGG
TGGTATGCATCCTGTTACCGATCAAATCTCAATGGTCGCTATGCAGTGTCTGAGGCTGCCGCCCACAAA
TATGGCATTGACTGGGCCTCAGGCCGTGGTGTGGGCCACCCCTACCGCAGGGTTCGGATGATGCTTCGA
TAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_003665
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_003665.3
RefSeq Size 1079 bp
RefSeq ORF 900 bp
Locus ID 8547
UniProt ID O75636
Protein Families Druggable Genome, Secreted Protein
MW 32.9 kDa
Gene Summary Ficolins are a group of proteins which consist of a collagen-like domain and a fibrinogen-like domain. In human serum, there are two types of ficolins, both of which have lectin activity. The protein encoded by this gene is a thermolabile beta-2-macroglycoprotein found in all human serum and is a member of the ficolin/opsonin p35 lectin family. The protein, which was initially identified based on its reactivity with sera from patients with systemic lupus erythematosus, has been shown to have a calcium-independent lectin activity. The protein can activate the complement pathway in association with MASPs and sMAP, thereby aiding in host defense through the activation of the lectin pathway. Alternative splicing occurs at this locus and two variants, each encoding a distinct isoform, have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...