DC2L1 (DYNC2LI1) (NM_001012665) Human Untagged Clone

CAT#: SC301695

DYNC2LI1 (untagged)-Human dynein, cytoplasmic 2, light intermediate chain 1 (DYNC2LI1), transcript variant 3



  "NM_001012665" in other vectors (4)

CNY 5420.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-DYNC2LI1 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-60; D2LIC; DKFZp564A033; dynein, cytoplasmic 2, light intermediate chain 1; dynein 2 light intermediate chain; LIC3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301695 representing NM_001012665.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCAGTGAAACTCTCTGGGAAATTGCAAAAGCTGAAGTGGAAAAAAGGGGAATTAATGGAAGTGAA
GGTGATGGAGCTGAAATTGCAGAAAAATTTGTTTTCTTCATTGGCAGTAAAAATGGGGGAAAGACTACT
ATTATTCTAAGGTGTCTTGACAGAGATGAACCACCAAAACCAACCTTAGCTTTGGAATATACATATGGA
AGAAGAGCAAAAGGGCACAACACACCAAAAGATATCGCTCACTTTTGGGAACTCGGTGGAGGAACCTCT
TTATTGGACTTAATCAGCATACCCATCACAGGTGACACCTTACGGACGTTTTCTCTTGTTCTCGTTCTG
GATCTTTCAAAACCTAATGATCTCTGGCCCACCATGGAAAATCTCTTGCAAGCCACAAAAAGCCATGTA
GACAAAGTGATAATGAAACTGGGAAAGACAAATGCTAAAGCAGTTTCTGAAATGAGACAGAAGATCTGG
AATAATATGCCGAAGGATCATCCTGATCATGAATTAATTGACCCATTTCCGGTACCTCTGGTCATAATT
GGAAGTAAATATGATGTTTTTCAGGATTTTGAGTCTGAGAAGAGAAAGGTAATATGCAAGACACTTCGA
TTTGTTGCACATTATTATGGAGCATCATTAATGTTTACCAGTAAATCAGAAGCTCTATTACTAAAAATA
CGTGGAGTTATCAACCAGTTGGCATTTGGCATTGACAAAAGCAAATCAATATGTGTGGATCAGAATAAA
CCGCTGTTTATCACAGCAGGATTGGATTCTTTCGGTCAAATAGGATCTCCTCCTGTTCCTGAAAATGAC
ATTGGAAAGCTTCATGCCCACTCACCTATGGAGTTGTGGAAAAAAGTGTATGAAAAGCTCTTTCCACCA
AAGAGTATTAACACGCTGAAAGATATCAAGGACCCTGCGAGAGATCCTCAGTATGCTGAAAATGAAGTC
GATGAGATGAGAATTCAGAAGGATCTGGTATTATCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001012665
Insert Size 1005 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001012665.1
RefSeq Size 1418 bp
RefSeq ORF 1005 bp
Locus ID 51626
MW 37.5 kDa
Gene Summary This gene encodes a protein that is a component of the dynein-2 microtubule motor protein complex that plays a role in the retrograde transport of cargo in primary cilia via the intraflagellar transport system. This gene is ubiquitously expressed and its protein, which localizes to the axoneme and Golgi apparatus, interacts directly with the cytoplasmic dynein 2 heavy chain 1 protein to form part of the multi-protein dynein-2 complex. Mutations in this gene produce defects in the dynein-2 complex which result in several types of ciliopathy including short-rib thoracic dysplasia 15 with polydactyly (SRTD15). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...