CACNB4 (NM_001005747) Human Untagged Clone
CAT#: SC301026
CACNB4 (untagged)-Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 1
CNY 5488.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CAB4; CACNLB4; EA5; EIG9; EJM; EJM4; EJM6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001005747, the custom clone sequence may differ by one or more nucleotides
ATGTATGACAATTTGTACCTGCATGGAATTGAAGACTCGGAGGCTGGTTCAGCGGATTCC TACACAAGCAGGCCGTCTGACTCCGATGTCTCTTTGGAAGAGGACCGGGAAGCAATTCGA CAGGAGAGAGAACAGCAAGCAGCTATCCAGCTTGAGAGAGCAAAGTCCAAACCTGTAGCA TTTGCCGTGAAGACAAATGTGAGCTACTGCGGCGCCCTGGACGAGGATGTGCCTGTTCCA AGCACAGCTATCTCCTTTGATGCTAAAGACTTTCTACATATTAAAGAGAAATATAACAAT GATTGGTGGATAGGAAGGCTGGTGAAAGAGGGCTGTGAAATTGGCTTCATTCCAAGTCCA CTCAGATTGGAGAACATACGGATCCAGCAAGAACAAAAAAGAGGACGTTTTCACGGAGGG AAATCAAGTGGAAATTCTTCTTCAAGTCTTGGAGAAATGGTATCTGGGACATTCCGAGCA ACTCCCACATCAACAGCAAAACAGAAGCAAAAAGTGACGGAGCACATTCCTCCTTACGAT GTTGTACCGTCAATGCGTCCGGTGGTGTTAGTGGGGCCGTCACTGAAAGGTTACGAGGTA ACAGACATGATGCAGAAAGCCCTCTTTGATTTCCTGAAGCACAGGTTTGATGGGAGGATT TCAATAACGAGAGTGACAGCTGACATTTCTCTTGCTAAGAGGTCTGTCCTAAATAATCCC AGCAAGAGAGCAATAATTGAACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTACAAAGT GAAATTGAAAGAATCTTTGAGTTGGCAAGATCTTTGCAACTGGTTGTTCTTGATGCAGAC ACCATCAATCACCCAGCACAACTTATAAAGACTTCCTTAGCACCAATTATTGTTCATGTA AAAGTCTCATCTCCAAAGGTTTTACAGCGGTTGATTAAATCTAGAGGAAAGTCACAAAGT AAACACTTGAATGTTCAACTGGTGGCAGCTGATAAACTTGCACAATGCCCCCCAGAAATG TTTGATGTTATATTGGATGAAAATCAGCTTGAGGATGCATGTGAACATCTAGGGGAGTAC CTGGAGGCGTACTGGCGTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTG GGAAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTGGGTTACAG AGTCAGCGAATGAGGCACAGCAACCACTCCACAGAGAACTCTCCAATTGAAAGACGAAGT CTAATGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTG TCTTCCAGTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGGAAGAAGATTACCCTGAC TCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCACCTGGGGGATATAGCCAT GACTCCCGACATAGGCTTTGA |
Restriction Sites | Please inquire |
ACCN | NM_001005747 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001005747.1, NP_001005747.1 |
RefSeq Size | 3185 bp |
RefSeq ORF | 1461 bp |
Locus ID | 785 |
UniProt ID | O00305 |
Protein Families | Druggable Genome, Ion Channels: Other |
Protein Pathways | Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway |
Gene Summary | This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE), juvenile myoclonic epilepsy (JME), and episodic ataxia, type 5. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (1) represents use of an alternate promoter and 5' UTR and differs in the 5' coding region, compared to variant 2. The resulting isoform (a) has a shorter and distinct N-terminus, compared to isoform b. This isoform has an a-type N-terminus. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221164 | CACNB4 (Myc-DDK-tagged)-Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 1 |
CNY 5488.00 |
|
RC221164L3 | Lenti ORF clone of Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 1, Myc-DDK-tagged |
CNY 6180.00 |
|
RC221164L4 | Lenti ORF clone of Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 1, mGFP tagged |
CNY 6180.00 |
|
RG221164 | CACNB4 (tGFP-tagged) - Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 1 |
CNY 4750.00 |