IGFL2 (NM_001002915) Human Untagged Clone
CAT#: SC300483
IGFL2 (untagged)-Human IGF-like family member 2 (IGFL2), transcript variant 1
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | UNQ645; VPRI645 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001002915, the custom clone sequence may differ by one or more nucleotides
ATGAGGTTCAGTGTCTCAGGCATGAGGACCGACTACCCCAGGAGTGTGCTGGCTCCTGCT TATGTGTCAGTCTGTCTCCTCCTCTTGTGTCCAAGGGAAGTCATCGCTCCCGCTGGCTCA GAACCATGGCTGTGCCAGCCGGCACCCAGGTGTGGAGACAAGATCTACAACCCCTTGGAG CAGTGCTGTTACAATGACGCCATCGTGTCCCTGAGCGAGACCCGCCAATGTGGTCCCCCC TGCACCTTCTGGCCCTGCTTTGAGCTCTGCTGTCTTGATTCCTTTGGCCTCACAAACGAT TTTGTTGTGAAGCTGAAGGTTCAGGGTGTGAATTCCCAGTGCCACTCATCTCCCATCTCC AGTAAATGTGAAAGCAGAAGACGTTTTCCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001002915 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001002915.1, NP_001002915.1 |
| RefSeq Size | 906 bp |
| RefSeq ORF | 372 bp |
| Locus ID | 147920 |
| UniProt ID | Q6UWQ7 |
| Protein Families | Secreted Protein |
| Gene Summary | IGFL2 belongs to the insulin-like growth factor (IGF; see MIM 147440) family of signaling molecules that play critical roles in cellular energy metabolism and in growth and development, especially prenatal growth (Emtage et al., 2006 [PubMed 16890402]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222557 | IGFL2 (Myc-DDK-tagged)-Human IGF-like family member 2 (IGFL2), transcript variant 1 |
CNY 1200.00 |
|
| RC222557L3 | Lenti-ORF clone of IGFL2 (Myc-DDK-tagged)-Human IGF-like family member 2 (IGFL2), transcript variant 1 |
CNY 5890.00 |
|
| RC222557L4 | Lenti-ORF clone of IGFL2 (mGFP-tagged)-Human IGF-like family member 2 (IGFL2), transcript variant 1 |
CNY 5890.00 |
|
| RG222557 | IGFL2 (tGFP-tagged) - Human IGF-like family member 2 (IGFL2), transcript variant 1 |
CNY 4370.00 |
|
| SC327731 | IGFL2 (untagged)-Human IGF-like family member 2 (IGFL2) transcript variant 1 |
CNY 3990.00 |
