Kallikrein 2 (KLK2) (NM_001002231) Human Untagged Clone
CAT#: SC300404
KLK2 (untagged)-Human kallikrein-related peptidase 2 (KLK2), transcript variant 2
CNY 2400.00
CNY 3990.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | hGK-1; hK2; KLK2A2 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001002231 edited
ATGTGGGACCTGGTTCTCTCCATCGCCTTGTCTGTGGGGTGCACTGGTGCCGTGCCCCTC ATCCAGTCTCGGATTGTGGGAGGCTGGGAGTGTGAGAAGCATTCCCAACCCTGGCAGGTG GCTGTGTACAGTCATGGATGGGCACACTGTGGGGGTGTCCTGGTGCACCCCCAGTGGGTG CTCACAGCTGCCCATTGCCTAAAGAAGAATAGCCAGGTCTGGCTGGGTCGGCACAACCTG TTTGAGCCTGAAGACACAGGCCAGAGGGTCCCTGTCAGCCACAGCTTCCCACACCCGCTC TACAATATGAGCCTTCTGAAGCATCAAAGCCTTAGACCAGATGAAGACTCCAGCCATGAC CTCATGCTGCTCCGCCTGTCAGAGCCTGCCAAGATCACAGATGTTGTGAAGGTCCTGGGC CTGCCCACCCAGGAGCCAGCACTGGGGACCACCTGCTACGCCTCAGGCTGGGGCAGCATC GAACCAGAGGAGTTCTTGCGCCCCAGGAGTCTTCAGTGTGTGAGCCTCCATCTCCTGTCC AATGACATGTGTGCTAGAGCTTACTCTGAGAAGGTGACAGAGTTCATGTTGTGTGCTGGG CTCTGGACAGGTGGTAAAGACACTTGTGGGGTGAGTCATCCCTACTCCCAACATCTGGAG GGGAAAGGGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001002231 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001002231.1, NP_001002231.1 |
RefSeq Size | 2892 bp |
RefSeq ORF | 672 bp |
Locus ID | 3817 |
UniProt ID | P20151 |
Protein Families | Druggable Genome, Protease |
Gene Summary | This gene encodes a member of the grandular kallikrein protein family. Kallikreins are a subgroup of serine proteases that are clustered on chromosome 19. Members of this family are involved in a diverse array of biological functions. The protein encoded by this gene is a highly active trypsin-like serine protease that selectively cleaves at arginine residues. This protein is primarily expressed in prostatic tissue and is responsible for cleaving pro-prostate-specific antigen into its enzymatically active form. This gene is highly expressed in prostate tumor cells and may be a prognostic maker for prostate cancer risk. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223935 | KLK2 (Myc-DDK-tagged)-Human kallikrein-related peptidase 2 (KLK2), transcript variant 2 |
CNY 2400.00 |
|
RC223935L3 | Lenti-ORF clone of KLK2 (Myc-DDK-tagged)-Human kallikrein-related peptidase 2 (KLK2), transcript variant 2 |
CNY 5890.00 |
|
RC223935L4 | Lenti-ORF clone of KLK2 (mGFP-tagged)-Human kallikrein-related peptidase 2 (KLK2), transcript variant 2 |
CNY 5890.00 |
|
RG223935 | KLK2 (tGFP-tagged) - Human kallikrein-related peptidase 2 (KLK2), transcript variant 2 |
CNY 4370.00 |
其它Kallikrein 2产品