Vrk2 (NM_001252447) Mouse Untagged Clone

CAT#: MC227777

Vrk2 (untagged) - Mouse vaccinia related kinase 2 (Vrk2), transcript variant 2



  "NM_001252447" in other vectors (1)

CNY 4370.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2810003O05Rik; AI447698
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227777 representing NM_001252447
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCACCAAGAAGAAAAGAGAAATATAAGCTTCCGGTTCCACTCCCAGAAGGCAAAATTCTGGATGATA
TGGAAGGAAACCGGTGGGCACTGGGCAAGATGATCGGCTCTGGAGGGTTTGGACTGATATACTTAGCTTT
CCCCACAAATAAACCAAACAAAGATGCAAGACATGTCATAAAGCTGGAGTATCAAGAAAATGGCCCATTA
TTTTCAGAGCTTAAATTTTATCAGAGAGCTGCAAAAAGAGAATGTATCCAAAAGTGGATACAACAGAGGA
AACTTGATTATTTAGGAATTCCTGTATTTTATGGATTTGGTCTGACTGATTTCAAAGGAAGAAGTTACAG
ATTCATGGTAATGGAAAGACTTGGAATAGATTTACAGAAACTCCTGGACCAGAATGGTGGTTTTAAAAAA
TTAACCGTCCTACAACTTGGCATCAGGATGCTGGATGTACTGGAATATATACATGAAAATGAGTATGTTC
ATGGTGATATAAAAGCCGCAAATCTACTGTTGGATTTTACAAATCCAGACCGGGTTTATCTTGCAGACTA
TGGACTTTCCTACAGATATTGTCCCAATGGGAACCACAAACAGTATCAGGAAGATCCCAGAAAGGGCCAT
AATGGGACAATAGAGTTTACAAGTTTGGATGCACACAAAGGAGTGGCCCCGTCCAGGAGGAGTGATGTTG
AAATCCTTGGTTACTGCATGCTGCACTGGCTCTTCGGGAAGCTTCCTTGGGAAGCAAAGCTGGACGACCC
TGTGGCTGTCCAGACTGCTAAAACCAACCTGCTGGATGAACTCCCAGAGTCGGTGCTTAAGTGGGCTCCT
TCTGGAAGCAGTTGCAGTGAACTTGTCAAGTACTTGATGTATGTTCATAATTTAGCTTATGATGACAAGC
CAGACTATCAGAAGCTCAAGAAAATTTTGAATCCAGATGGAGTACCTTTAGGGCCACTGGAATTTTCCAC
TAAAGTACAGAGTGTCCATGTGCGGACTCCAGCCCAACAAAAAGAAAACTCAAGGACAAGGAAAATACAT
GAATATTCTGATATTTTCAGTGAGATGCAGAGTCTTCAACAAACACCCAGCTATATGAGTTTCCAAGGTT
CATATTGCAAGCCCTATCTGGACTGCACTAGAAGAGATCCCATCAGGAAGCCAAGATCCCTGCCTCGGTA
CAGACACACGCCCACGGGTAATCTGGGAGTCACAGACTTGGAAAGTTCTCCAAGGTTTTGGCCTGCAATT
TTTCAGTTGACTCTGAGTGAAGAGACAAAGGCAGATGTGTATTACTATGGGATCACTATATTCTGTCTGC
TGATATTTGTATTTCTTGCTTTGTATTTTCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001252447
Insert Size 1365 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252447.1, NP_001239376.1
RefSeq Size 1745 bp
RefSeq ORF 1365 bp
Locus ID 69922
UniProt ID Q8BN21
Gene Summary Serine/threonine kinase that regulates several signal transduction pathways. Isoform 1 modulates the stress response to hypoxia and cytokines, such as interleukin-1 beta (IL1B) and this is dependent on its interaction with MAPK8IP1, which assembles mitogen-activated protein kinase (MAPK) complexes. Inhibition of signal transmission mediated by the assembly of MAPK8IP1-MAPK complexes reduces JNK phosphorylation and JUN-dependent transcription. Phosphorylates histone H3. Phosphorylates 'Thr-18' of p53/TP53, and thereby increases its stability and activity. Phosphorylates BANF1 and disrupts its ability to bind DNA and reduces its binding to LEM domain-containing proteins. Downregulates the transactivation of transcription induced by ERBB2, HRAS, BRAF, and MEK1. Blocks the phosphorylation of ERK in response to ERBB2 and HRAS. May also phosphorylate MAPK8IP1. Can also phosphorylate the following substrates that are commonly used to establish in vitro kinase activity: casein, MBP and histone H2B, but it is not sure that this is physiologically relevant (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an in-frame exon in the 3' coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment in the C-terminal region, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...