Nodal (NM_013611) Mouse Untagged Clone
CAT#: MC209046
Nodal (untagged) - Mouse nodal (Nodal), (10ug)
CNY 3656.00
CNY 3990.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Tg.413d |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209046 representing NM_013611
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_013611 |
Insert Size | 1065 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_013611.4, NP_038639.2 |
RefSeq Size | 2094 bp |
RefSeq ORF | 1065 bp |
Locus ID | 18119 |
UniProt ID | P43021 |
Gene Summary | This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which regulates early embryonic development. Homozygous knockout mice for this gene exhibit early embryonic lethality, while expression of a hypomorphic allele results in defects in anteroposterior and left-right patterning. [provided by RefSeq, Aug 2016] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Nodal mitigates cerebral ischemia-reperfusion injury via inhibiting oxidative stress and inflammation
,Cui, Y;Wang, JQ;Shi, XH;Wang, YY;Liu, HY;Li, Z;Dong, Y;Mang, J;Xu, ZX;,
Eur Rev Med Pharmacol Sci
,PubMed ID 31298343
[NODAL]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226998 | Nodal (tGFP-tagged) - Mouse nodal (Nodal), (10ug) |
CNY 3140.00 |
|
MR226998 | Nodal (Myc-DDK-tagged) - Mouse nodal (Nodal) |
CNY 3656.00 |
|
MR226998L3 | Lenti ORF clone of Nodal (Myc-DDK-tagged) - Mouse nodal (Nodal) |
CNY 4750.00 |
|
MR226998L4 | Lenti ORF clone of Nodal (mGFP-tagged) - Mouse nodal (Nodal) |
CNY 4750.00 |