Mef2c (NM_025282) Mouse Untagged Clone

CAT#: MC208956

Mef2c (untagged) - Mouse myocyte enhancer factor 2C (Mef2c), transcript variant 2, (10ug)



  "NM_025282" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
MEF2C Antibody - N-terminal region
    • 50 ug

CNY 4,381.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 5430401D19Rik; 9930028G15Rik; AV011172; Mef2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208956 representing NM_025282
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGAGAAAAAAGATTCAGATTACGAGGATAATGGATGAGCGTAACAGACAGGTGACTTTTACGAAGA
GGAAATTTGGATTGATGAAGAAGGCTTATGAGCTGAGCGTGCTGTGCGACTGTGAGATTGCACTGATCAT
CTTCAACAGCACCAACAAGCTGTTCCAGTACGCCAGCACTGACATGGATAAGGTGTTGCTCAAGTACACC
GAGTACAACGAGCCGCACGAGAGCCGGACAAACTCAGACATTGTGGAGGCATTGAACAAGAAAGAAAACA
AAGGCTCTGAAAGCCCCGATCCTGACTCCTCTTATGCACTCACCCCACGCACTGAAGAAAAATACAAAAA
AATTAATGAAGAATTTGATAATATGATCAAGAGTCATAAAATTCCTGCTGTTCCACCTCCCAGCTTTGAG
ATGCCAGTTACCATCCCAGTGTCCAGCCATAACAGTTTGGTGTACAGCAATCCTGTCAGCACACTGGGAA
ACCCCAATCTTCTGCCACTGGCCCACCCGTCTCTGCAGAGGAATAGTATGTCTCCTGGTGTAACACATAG
ACCTCCAAGTGCAGGTAACACAGGCGGTCTGATGGGCGGAGATCTGACATCCGGTGCAGGCACCAGCGCA
GGGAATGGATACGGCAACCCCCGGAACTCACCAGGCCTGCTGGTCTCACCTGGTAACCTGAACAAGAATA
TACAAGCCAAATCTCCTCCCCCTATGAATCTAGGAATGAATAATCGTAAGCCAGATCTCCGCGTTCTTAT
CCCACCTGGCAGCAAGAACACGATGCCATCAGTGAATCAAAGGATAAATAACTCCCAGTCGGCTCAGTCA
TTGGCTACCCCGGTGGTTTCCGTAGCAACTCCTACTTTACCAGGACAAGGAATGGGAGGATATCCATCAG
CCATTTCAACAACATATGGTACTGAGTACTCTCTGAGTAGCGCAGATCTGTCATCTCTGTCTGGCTTCAA
CACTGCCAGTGCGCTCCACCTCGGCTCTGTAACTGGCTGGCAGCAGCAGCACCTACATAACATGCCGCCA
TCTGCCCTCAGTCAGTTGGGAGACCGTACCACCACCCCTTCGAGATACCCACAACACACCACGCGCCACG
AGGCGGGGAGGTCTCCTGTTGACAGCTTGAGCAGCTGTAGCAGTTCCTACGATGGGAGCGACCGAGAGGA
TCACCGGAACGAATTCCACTCCCCCATTGGACTCACCAGACCTTCGCCGGACGAAAGGGAAAGTCCTTCA
GTCAAGCGCATGCGACTCTCTGAAGGATGGGCAACATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_025282
Insert Size 1299 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_025282.3, NP_079558.1
RefSeq Size 6325 bp
RefSeq ORF 1299 bp
Locus ID 17260
UniProt ID Q8CFN5
Gene Summary Transcription activator which binds specifically to the MEF2 element present in the regulatory regions of many muscle-specific genes. Controls cardiac morphogenesis and myogenesis, and is also involved in vascular development. Enhances transcriptional activation mediated by SOX18 (PubMed:11554755). May also be involved in neurogenesis and in the development of cortical architecture. Isoforms that lack the repressor domain are more active than isoform 1 (By similarity). Plays an essential role in hippocampal-dependent learning and memory by suppressing the number of excitatory synapses and thus regulating basal and evoked synaptic transmission. Crucial for normal neuronal development, distribution, and electrical activity in the neocortex. Necessary for proper development of megakaryocytes and platelets and for bone marrow B-lymphopoiesis. Required for B-cell survival and proliferation in response to BCR stimulation, efficient IgG1 antibody responses to T-cell-dependent antigens and for normal induction of germinal center B-cells.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains an alternate in-frame exon in the 5' coding region, lacks an in-frame exon in the central coding region, and uses an alternate in-frame splice site in the 3' coding region, compared to variant 3. The encoded isoform (2) is shorter than isoform 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...