Rnf185 (BC014812) Mouse Untagged Clone

CAT#: MC206976

Rnf185 (untagged) - Mouse ring finger protein 185 (cDNA clone MGC:19394 IMAGE:3153870), (10ug)



  "BC014812" in other vectors (4)

CNY 3230.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms MGC19394
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC206976 representing BC014812.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAAGTAAAGGGCCTTCGGCCTCTGCATCCACTGAGAATTCCAATGCAGGGGGGCCCAGTGGCAGC
AGCAATGGCACTGGTGAGAGTGGAGGGCAGGACAGCACCTTTGAGTGCAACATATGCCTGGACACAGCC
AAGGATGCTGTCATCAGCCTGTGTGGCCACCTCTTCTGTTGGCCGTGTTTACATCAGTGGTTGGAGACT
AGGCCTAACAGACAAGTGTGTCCAGTCTGCAAAGCTGGCATCAGCCGAGACAAAGTCATCCCCCTCTAT
GGCAGAGGCAGCACTGGACAGCAGGATCCCAGAGAGAAGACTCCTCCTCGTCCTCAAGGCCAGAGGCCA
GAGCCAGAAAATAGAGGGGGATTTCAAGGATTTGGATTTGGAGATGGTGGCTTTCAGATGTCTTTTGGA
ATTGGAGCATTTCCATTTGGGATATTTGCCACAGCATTTAACATAAATGATGGACGGCCTCCTCCAGCT
GTCCCTGGGACACCCCAGTATGTGGATGAGCAGTTCCTGTCACGCCTCTTCCTGTTTGTCGCCCTGGTG
ATCATGTTCTGGCTCCTGATCGCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN BC014812
Insert Size 579 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC014812
RefSeq Size 2736 bp
RefSeq ORF 578 bp
Locus ID 193670
MW 20.5 kDa
Gene Summary E3 ubiquitin-protein ligase that regulates selective mitochondrial autophagy by mediating 'Lys-63'-linked polyubiquitination of BNIP1. Acts in the endoplasmic reticulum (ER)-associated degradation (ERAD) pathway, which targets misfolded proteins that accumulate in the endoplasmic reticulum (ER) for ubiquitination and subsequent proteasome-mediated degradation. Protects cells from ER stress-induced apoptosis. Responsible for the cotranslational ubiquitination and degradation of CFTR in the ERAD pathway. Preferentially associates with the E2 enzymes UBE2J1 and UBE2J2 (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...