Rnf185 (BC014812) Mouse Untagged Clone
CAT＃: MC206976
Rnf185 (untagged) - Mouse ring finger protein 185 (cDNA clone MGC:19394 IMAGE:3153870), (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | MGC19394 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206976 representing BC014812.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAAGTAAAGGGCCTTCGGCCTCTGCATCCACTGAGAATTCCAATGCAGGGGGGCCCAGTGGCAGC AGCAATGGCACTGGTGAGAGTGGAGGGCAGGACAGCACCTTTGAGTGCAACATATGCCTGGACACAGCC AAGGATGCTGTCATCAGCCTGTGTGGCCACCTCTTCTGTTGGCCGTGTTTACATCAGTGGTTGGAGACT AGGCCTAACAGACAAGTGTGTCCAGTCTGCAAAGCTGGCATCAGCCGAGACAAAGTCATCCCCCTCTAT GGCAGAGGCAGCACTGGACAGCAGGATCCCAGAGAGAAGACTCCTCCTCGTCCTCAAGGCCAGAGGCCA GAGCCAGAAAATAGAGGGGGATTTCAAGGATTTGGATTTGGAGATGGTGGCTTTCAGATGTCTTTTGGA ATTGGAGCATTTCCATTTGGGATATTTGCCACAGCATTTAACATAAATGATGGACGGCCTCCTCCAGCT GTCCCTGGGACACCCCAGTATGTGGATGAGCAGTTCCTGTCACGCCTCTTCCTGTTTGTCGCCCTGGTG ATCATGTTCTGGCTCCTGATCGCCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC014812 |
| Insert Size | 579 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC014812 |
| RefSeq Size | 2736 bp |
| RefSeq ORF | 578 bp |
| Locus ID | 193670 |
| MW | 20.5 kDa |
| Gene Summary | E3 ubiquitin-protein ligase that regulates selective mitochondrial autophagy by mediating 'Lys-63'-linked polyubiquitination of BNIP1. Acts in the endoplasmic reticulum (ER)-associated degradation (ERAD) pathway, which targets misfolded proteins that accumulate in the endoplasmic reticulum (ER) for ubiquitination and subsequent proteasome-mediated degradation. Protects cells from ER stress-induced apoptosis. Responsible for the cotranslational ubiquitination and degradation of CFTR in the ERAD pathway. Preferentially associates with the E2 enzymes UBE2J1 and UBE2J2 (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201843 | Rnf185 (tGFP-tagged) - Mouse ring finger protein 185 (cDNA clone MGC:19394 IMAGE:3153870) |
CNY 2850.00 |
|
| MR201843 | Rnf185 (Myc-DDK-tagged) - Mouse ring finger protein 185 (cDNA clone MGC:19394 IMAGE:3153870) |
CNY 2400.00 |
|
| MR201843L3 | Lenti ORF clone of Rnf185 (Myc-DDK-tagged) - Mouse ring finger protein 185 (cDNA clone MGC:19394 IMAGE:3153870) |
CNY 4750.00 |
|
| MR201843L4 | Lenti ORF clone of Rnf185 (mGFP-tagged) - Mouse ring finger protein 185 (cDNA clone MGC:19394 IMAGE:3153870) |
CNY 4750.00 |
