Ube2i (BC037635) Mouse Untagged Clone
CAT#: MC206861
Ube2i (untagged) - Mouse ubiquitin-conjugating enzyme E2I (cDNA clone MGC:46871 IMAGE:4951933), (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Mmubc9, UBC9, 5830467E05Rik |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206861 representing BC037635.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGGGGATCGCCCTCAGCCGCCTTGCGCAGGAAAGGAAAGCCTGGAGGAAGGACCACCCTTTTGGC TTTGTAGCTGTCCCAACAAAGAACCCTGATGGCACAATGAACCTGATGAACTGGGAGTGCGCTATCCCT GGAAAGAAGGGGACTCCATGGGAAGGAGGCTTGTTCAAGCTACGGATGCTTTTCAAAGATGACTATCCG TCCTCACCACCAAAATGTAAGTTGTGCAAAGAGCCTGCAGTCCACTTCCCAGCACTACCACCACCCTTT GGGAGCCATGTCTGTGAGTGCTTGGCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC037635 |
| Insert Size | 306 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC037635 |
| RefSeq Size | 2252 bp |
| RefSeq ORF | 305 bp |
| Locus ID | 22196 |
| MW | 11.2 kDa |
| Gene Summary | Accepts the ubiquitin-like proteins SUMO1, SUMO2 and SUMO3 from the UBLE1A-UBLE1B E1 complex and catalyzes their covalent attachment to other proteins with the help of an E3 ligase such as RANBP2, CBX4 and ZNF451. Can catalyze the formation of poly-SUMO chains. Essential for nuclear architecture, chromosome segregation and embryonic viability. Necessary for sumoylation of FOXL2 and KAT5 (By similarity). Sumoylates p53/TP53 at 'Lys-386'.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200308 | Ube2i (tGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2I (cDNA clone MGC:46871 IMAGE:4951933) |
CNY 2850.00 |
|
| MR200308 | Ube2i (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2I (cDNA clone MGC:46871 IMAGE:4951933) |
CNY 1200.00 |
|
| MR200308L3 | Lenti ORF clone of Ube2i (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2I (cDNA clone MGC:46871 IMAGE:4951933) |
CNY 4750.00 |
|
| MR200308L4 | Lenti ORF clone of Ube2i (mGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2I (cDNA clone MGC:46871 IMAGE:4951933) |
CNY 4750.00 |
