Cbr1 (NM_007620) Mouse Untagged Clone
CAT#: MC204275
Cbr1 (untagged) - Mouse carbonyl reductase 1 (Cbr1), (10ug)
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AW261796; Cbr; CR |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC012714
CCACGCGTCCGCCCACGCGTCCGCTTGGTCTCCGACGGCCTCCCTTCTCACGCAGCCATGTCTTCCAGCA GACCCGTGGCGCTGGTGACCGGTGCTAACAAAGGAATCGGATTCGCGATCACTCGTGACCTGTGTCGGAA ATTCTCCGGGGACGTGGTGCTCGCGGCGCGGGACGAGGAGCGGGGCCAAACGGCAGTGCAAAAGCTGCAG GCGGAGGGCCTGAGCCCACGCTTCCACCAGCTGGACATCGACAACCCGCAGAGCATTCGCGCACTGCGCG ACTTTCTGCTCAAGGAATACGGAGGCCTGGACGTGCTGGTCAACAACGCAGGCATCGCCTTCAAGGTCAA TGACGACACCCCCTTCCACATTCAAGCAGAGGTGACAATGAAAACGAACTTTTTTGGTACCCGAGATGTC TGCAAGGAGCTGCTCCCTCTAATAAAACCCCAAGGCAGAGTGGTGAATGTGTCCAGCATGGTGAGTCTCA GGGCCCTGAAAAACTGCAGGCTGGAGCTGCAGCAGAAGTTTCGAAGCGAGACCATCACAGAGGAGGAGCT GGTGGGGCTCATGAACAAGTTTGTGGAAGATACAAAGAAAGGAGTCCATGCGGAAGAAGGTTGGCCTAAT AGTGCATATGGGGTCACCAAGATTGGGGTGACAGTCCTGTCCAGAATCCTTGCCAGGAAACTCAATGAGC AGAGGAGAGGGGACAAGATCCTTCTGAATGCCTGCTGCCCTGGGTGGGTCAGAACCGACATGGCAGGACC AAAAGCCACCAAAAGCCCAGAAGAAGGAGCAGAGACCCCTGTGTACTTGGCCCTTTTGCCTCCAGATGCA GAGGGGCCTCATGGGCAGTTTGTTCAAGATAAAAAAGTTGAACCATGGTGAACCCAACTCTCACCTCCCA CCCCCTTGTATCCAGACTTGCTGAAGGCCAAGGACATTTATAATGTAGTAACACTTCTGAAAAATAAACA TAGAATTCTTTGAATGCACAGAGGTTTAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_007620 |
Insert Size | 834 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC012714, AAH12714 |
RefSeq Size | 1024 bp |
RefSeq ORF | 834 bp |
Locus ID | 12408 |
UniProt ID | P48758 |
Gene Summary | NADPH-dependent reductase with broad substrate specificity. Catalyzes the reduction of a wide variety of carbonyl compounds including quinones, prostaglandins, menadione, plus various xenobiotics. Catalyzes the reduction of the antitumor anthracyclines doxorubicin and daunorubicin to the cardiotoxic compounds doxorubicinol and daunorubicinol. Can convert prostaglandin E2 to prostaglandin F2-alpha. Can bind glutathione, which explains its higher affinity for glutathione-conjugated substrates. Catalyzes the reduction of S-nitrosoglutathione (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203724 | Cbr1 (tGFP-tagged) - Mouse carbonyl reductase 1 (Cbr1) |
CNY 5,200.00 |
|
MR203724 | Cbr1 (Myc-DDK-tagged) - Mouse carbonyl reductase 1 (Cbr1) |
CNY 3,600.00 |
|
MR203724L3 | Lenti ORF clone of Cbr1 (Myc-DDK-tagged) - Mouse carbonyl reductase 1 (Cbr1) |
CNY 5,890.00 |
|
MR203724L4 | Lenti ORF clone of Cbr1 (mGFP-tagged) - Mouse carbonyl reductase 1 (Cbr1) |
CNY 5,890.00 |