Nmral1 (NM_026393) Mouse Untagged Clone
CAT#: MC201364
Nmral1 (untagged) - Mouse NmrA-like family domain containing 1 (Nmral1), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1110025F24Rik; AI256624 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC030039 sequence for NM_026393
GGGTATTGCCAGACAGAATCTCGGGACGCGTTCAGGGACCGGACGTCTCAGGGTAGAGATTCTGCCCTTC GCCAACTCTGCCACCCCAGGCCTCTTTGGATCACGCTCTTTGGGCTCTGGACCCCATGGCTGATAGGAAA CTGGTGGTGGTTTTTGGAGCCACAGGTGCGCAAGGTGGCTCTGTGGCCCGTGCATTGCTAGAAGATGGGA CATTCAGGATTCGAGTGGTAACAAGAAACCCTGAGCAGAGGGCAGCCAAAGAGCTGAAGCAGCAAGGTGC TGAGGTAGTGCGAGGAGACCAGGACGATGCAGCTAGCATGGAGCTGGCCTTGGCTGGAGCCCATGCCACC TTCATTGTGACCAATTACTGGGAGACGTGCAGCCAGGACCGAGAAGTGCAGCAGCCCCACCAGTGGGACC AAGTATTCAAACAAGGCAAGCTTCTAGCCGATCTAGCCAAACGCTTGGGCCTCCATTATGTAGTGTACAG TGGCCTGGAGAACATCAGGAAGCTGACGGCTGGGAAGCTGGCCGCAGGACACTTTGATGGCAAAGGGGAG GTGGAGGAATACTTCCGAGACATCGGTGTTCCCATGACCAGTGTGCGGCTGCCTTGCTATTTCGAGAATC TCCTTTCCTATTTCCTGCCCCAGAAAGCTGCAGATGGAAAAAGCTTCTTGCTGGACTTGCCCATGGGTGA CGTCCCCATGGATGGAATGTCTGTGAGTGACCTGGGCCCCGTGGTGCTCAGCTTGCTGAAGAAGCCAGAA GAGTACGTAGGGCAGAACATCGGGCTCAGTACCTGCAGGCACACCGCAGAGGAGTATGCTGCCTTGCTTA GCAAGCACACTGGCAAGGCTGTACATCATGCCAAGACAACTCCTGAGGATTACGAGAAACTTGGTTTCCA GGGGGCTCAAGACTTGGCCAACATGTTCCGTTTCTACACCCTGAAACCTGATCGGAACATTCATCTGACC CTGCGACTCAACCCCAAAGCCCAGACACTGGACCAGTGGCTGGAGCAGCACAAAGGGGACTTTGCACAGC TGTGATCTTGAAGCATTTGTAGGGACAACAAGCACAACAAACACTCTTTCTTGTATACAGTTCTGTGTTT GGGTTTTTTTTCCCTCCCAAATAAAACCATTGTTATCACAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | EcoRI-NotI |
| ACCN | NM_026393 |
| Insert Size | 930 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC030039, AAH30039 |
| RefSeq Size | 1186 bp |
| RefSeq ORF | 930 bp |
| Locus ID | 67824 |
| UniProt ID | Q8K2T1 |
| Gene Summary | Redox sensor protein. Undergoes restructuring and subcellular redistribution in response to changes in intracellular NADPH/NADP(+) levels. At low NADPH concentrations the protein is found mainly as a monomer, and binds argininosuccinate synthase (ASS1), the enzyme involved in nitric oxide synthesis. Association with ASS1 impairs its activity and reduces the production of nitric oxide, which subsecuently prevents apoptosis. Under normal NADPH concentrations, the protein is found as a dimer and hides the binding site for ASS1. The homodimer binds one molecule of NADPH. Has higher affinity for NADPH than for NADP(+). Binding to NADPH is necessary to form a stable dimer (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG204373 | Nmral1 (tGFP-tagged) - Mouse NmrA-like family domain containing 1 (Nmral1) |
CNY 2850.00 |
|
| MR204373 | Nmral1 (Myc-DDK-tagged) - Mouse NmrA-like family domain containing 1 (Nmral1) |
CNY 2400.00 |
|
| MR204373L3 | Lenti ORF clone of Nmral1 (Myc-DDK-tagged) - Mouse NmrA-like family domain containing 1 (Nmral1) |
CNY 4750.00 |
|
| MR204373L4 | Lenti ORF clone of Nmral1 (mGFP-tagged) - Mouse NmrA-like family domain containing 1 (Nmral1) |
CNY 4750.00 |
