Dnmt3b Mouse qPCR Primer Pair (NM_001122997)

CAT#: MP220327

qSTAR qPCR primer pairs against mus musculus gene Dnmt3b



CNY 1140.00


货期*
5周

规格
    • 200 reactions

Product images

推荐一起购买 (12)
Dnmt3b (myc-DDK-tagged) - Mouse DNA methyltransferase 3B (Dnmt3b), transcript variant 7
    • 10 ug

CNY 6152.00
CNY 7130.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2710.00


Dnmt3b (myc-DDK-tagged) - Mouse DNA methyltransferase 3B (Dnmt3b), transcript variant 9
    • 10 ug

CNY 5688.00
CNY 5800.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1330.00


Dnmt3b (Myc-DDK-tagged) - Mouse DNA methyltransferase 3B (Dnmt3b), transcript variant 1
    • 10 ug

CNY 9432.00


Dnmt3b (myc-DDK-tagged) - Mouse DNA methyltransferase 3B (Dnmt3b), transcript variant 6
    • 10 ug

CNY 6288.00
CNY 8550.00


Dnmt3b (Myc-DDK-tagged) - Mouse DNA methyltransferase 3B (Dnmt3b), transcript variant 4
    • 10 ug

CNY 7980.00


Dnmt3b (myc-DDK-tagged) - Mouse DNA methyltransferase 3B (Dnmt3b), transcript variant 8
    • 10 ug

CNY 7980.00


Dnmt3b (Myc-DDK-tagged) - Mouse DNA methyltransferase 3B (Dnmt3b), transcript variant 2
    • 10 ug

CNY 6144.00
CNY 7130.00


Dnmt3b (Myc-DDK-tagged) - Mouse DNA methyltransferase 3B (Dnmt3b), transcript variant 5
    • 10 ug

CNY 9448.00


Dnmt3b (Myc-DDK-tagged) - Mouse DNA methyltransferase 3B (Dnmt3b), transcript variant 3
    • 10 ug

CNY 5688.00
CNY 5800.00

Specifications

Product Data
Gene ID 13436
Forward Sequence CGCACAACCAATGACTCTGCTG
Reverse Sequence GGTGACTTCAGAAGCCATCCGT
Synonyms MmuIIIB
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...