Tnf Mouse qPCR Primer Pair (NM_013693)
CNY 1140.00
货期*
                        4周
                    规格
                        | Cited in 6 publications. | 
Product images
 
                    
                
                         推荐一起购买 (6)
                    
                    
                                        A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
                                    
                                CNY 2710.00
Specifications
| Product Data | |
| Gene ID | 21926 | 
| Forward Sequence | GGTGCCTATGTCTCAGCCTCTT | 
| Reverse Sequence | GCCATAGAACTGATGAGAGGGAG | 
| Synonyms | DI; DIF; Tn; TNF-; TNF-a; TNF-alpha; Tnfa; TNFalpha; Tnfs; Tnfsf1a; TNFSF2; Tnlg1f | 
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. | 
| Storage & Stability | Store at -20°C. | 
Citations (6)
| The use of this Gene Expression has been cited in the following citations: | 
|---|
| Leishmania-Specific Promiscuous Membrane Protein Tubulin Folding Cofactor D Divulges Th1/Th2 Polarization in the Host via ERK-1/2 and p38 MAPK Signaling Cascade
                                                ,Jamal, F;Singh, MK;Hansa, J;Pushpanjali, ;Ahmad, G;Dikhit, MR;Umar, MS;Bimal, S;Das, P;Mujeeb, AA;Singh, SK;Zubair, S;Owais, M;,
                                                Front Immunol
                                                ,PubMed ID 32582140
                                                [TNF] | 
| Neutrophils develop rapid proinflammatory response after engulfing Hb-activated platelets under intravascular hemolysis
                                                ,Bhasym, A;Annarapu, GK;Saha, S;Shrimali, N;Gupta, S;Seth, T;Guchhait, P;,
                                                Clin. Exp. Immunol.
                                                ,PubMed ID 31099890
                                                [TNF] | 
| MLN4924 protects against interleukin-17A-induced pulmonary inflammation by disrupting ACT1-mediated signaling
                                                ,Hao, R;Song, Y;Li, R;Wu, Y;Yang, X;Li, X;Qian, F;Ye, RD;Sun, L;,
                                                Am. J. Physiol. Lung Cell Mol. Physiol.
                                                ,PubMed ID 30892082
                                                [TNF] | 
| Initial <i>in vitro</i> development of a potassium-based intra-articular injection for osteoarthritis
                                                ,Erndt-Marino, JD;Diaz-Rodriguez, P;Hahn, M;,
                                                Tissue Eng Part A
                                                ,PubMed ID 29562839
                                                [TNF] | 
| Oxidized Guanine Base Lesions Function in 8-Oxoguanine DNA Glycosylase-1-mediated Epigenetic Regulation of Nuclear Factor κB-driven Gene Expression  *
                                                ,null,
                                                The Journal of Biological Chemistry
                                                ,PubMed ID 27756845
                                                [Tnf] | 
| Dexamethasone nanowafer as an effective therapy for dry eye disease
                                                ,Coursey, TG;Henriksson, JT;Marcano, DC;Shin, CS;Isenhart, LC;Ahmed, F;De Paiva, CS;Pflugfelder, SC;Acharya, G;,
                                                J Control Release
                                                ,PubMed ID 26184051
                                                [TNF] | 
Documents
| FAQs | 
Resources
| 基因表达相关资源 | 
                         Customer
                                Reviews 
                    
                    
                                Loading...
                            
                        
 
        