Trim24 Mouse qPCR Primer Pair (NM_145076)
CNY 1140.00
| Cited in 3 publications. |
Product images
CNY 2710.00
CNY 9790.00
CNY 10170.00
Specifications
| Product Data | |
| Gene ID | 21848 |
| Forward Sequence | CTAAATGGGCTGTTTCCAGTGGC |
| Reverse Sequence | GGTGTTGGTCACAGGAGAAGCA |
| Synonyms | A130082H20Rik; AI447469; D430004I05Rik; Tif; TIF1; TIF1-alpha; Tif1a; TIF1alpha |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage & Stability | Store at -20°C. |
Citations (3)
| The use of this Gene Expression has been cited in the following citations: |
|---|
|
BMP8A promotes survival and drug resistance via Nrf2/TRIM24 signaling pathway in clear cell renal cell carcinoma, et al. BMP8A promotes survival and drug resistance via Nrf2/TRIM24 signaling pathway in clear cell renal cell carcinoma
,null,
Cancer Science
,PubMed ID 32128917
[Trim24]
|
|
Overexpression of TRIM24 Stimulates Proliferation and Glucose Metabolism of Head and Neck Squamous Cell Carcinoma
,null,
BioMed Research International
,PubMed ID 29862279
[Trim24]
|
|
Clinical significance and biological roles of TRIM24 in human bladder carcinoma.
,null,
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine
,PubMed ID 25846736
[Trim24]
|
Documents
| FAQs |
Resources
| 基因表达相关资源 |
