Gnas Mouse qPCR Primer Pair (NM_010309)

CAT#: MP205684

qSTAR qPCR primer pairs against Mus musculus gene Gnas



CNY 1140.00


货期*
5周

规格
    • 200 reactions

Product images

推荐一起购买 (12)
GNAS Antibody - N-terminal region
    • 50 ug

CNY 4628.00


Gnas (Myc-DDK-tagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 7
    • 10 ug

CNY 5488.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2710.00


Gnas (Myc-DDK-tagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 1
    • 10 ug

CNY 7220.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1330.00


Gnas (Myc-DDK-tagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 1
    • 10 ug

CNY 11310.00


Gnas (Myc-DDK-tagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 6
    • 10 ug

CNY 8740.00


Gnas (myc-DDK-tagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 4
    • 10 ug

CNY 2570.00


Gnas (Myc-DDK-tagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 5
    • 10 ug

CNY 11120.00


Gnas (Myc-DDK-tagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 8
    • 10 ug

CNY 3800.00


Gnas (Myc-DDK-tagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 3
    • 10 ug

CNY 2570.00

Specifications

Product Data
Gene ID 14683
Forward Sequence CCATTGAGATGCGAGAGCAGAAG
Reverse Sequence GGTGCTTTTGCCAGACTCTCCA
Synonyms 5530400H20Rik; A930027G11Rik; C130027O20Rik; G; Ga; Galphas; Gn; Gnas1; Gnasxl; GPSA; Gs-; Gs-alpha; Gsa; GSP; N; Nes; Nesp; Nesp55; Nespl; Oed; Oed-Sml; Oedsml; P; P1; P2; P3; PHP1A; PHP1B; POH; SCG; SCG6; XL
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...