Mtor Mouse qPCR Primer Pair (NM_020009)
CNY 1140.00
Cited in 4 publications. |
Product images

CNY 16824.00
CNY 2710.00
Specifications
Product Data | |
Gene ID | 56717 |
Forward Sequence | AGAAGGGTCTCCAAGGACGACT |
Reverse Sequence | GCAGGACACAAAGGCAGCATTG |
Synonyms | 2610315D21Rik; AI327068; flat; FRAP; Frap1; FRAP2; RAFT1; RAPT1 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (4)
The use of this Gene Expression has been cited in the following citations: |
---|
The Functional Proximal Proteome of Oncogenic Ras Includes mTORC2
,null,
Molecular cell
,PubMed ID 30639242
[Mtor]
|
An integrated genomic analysis of papillary renal cell carcinoma type 1 uncovers the role of focal adhesion and extracellular matrix pathways), An integrated genomic analysis of papillary renal cell carcinoma type 1 uncovers the role of focal adhesion and extracellular matrix pathways
,null,
Molecular Oncology
,PubMed ID 26051997
[Mtor]
|
mTOR direct interactions with Rheb-GTPase and raptor: sub-cellular localization using fluorescence lifetime imaging
,null,
BMC Cell Biology
,PubMed ID 23311891
[Mtor]
|
Mammalian Target of Rapamycin (mTOR) and S6 Kinase Down-regulate Phospholipase D2 Basal Expression and Function *
,null,
The Journal of Biological Chemistry
,PubMed ID 20410302
[Mtor]
|
Documents
FAQs |
Resources
基因表达相关资源 |