SLC26A6 Human qPCR Primer Pair (NM_022911)

CAT#: HP232409

qSTAR qPCR primer pairs against Homo sapiens gene SLC26A6



CNY 1140.00


货期*
5周

规格
    • 200 reactions

Cited in 1 publication.

Product images

推荐一起购买 (10)
Goat Anti-SLC26A6 Antibody
    • 100 ug

CNY 5371.00


SLC26A6 (Myc-DDK-tagged)-Human solute carrier family 26, member 6 (SLC26A6), transcript variant 2
    • 10 ug

CNY 5552.00
CNY 5800.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2710.00


SLC26A6 (myc-DDK-tagged) - Human solute carrier family 26 (anion exchanger), member 6 (SLC26A6), transcript variant 6
    • 10 ug

CNY 4560.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1330.00


SLC26A6 (myc-DDK-tagged) - Human solute carrier family 26 (anion exchanger), member 6 (SLC26A6), transcript variant 5
    • 10 ug

CNY 5800.00


SLC26A6 (Myc-DDK-tagged)-Human solute carrier family 26, member 6 (SLC26A6), transcript variant 1
    • 10 ug

CNY 7600.00


SLC26A6 (Myc-DDK-tagged)-Human solute carrier family 26, member 6 (SLC26A6), transcript variant 4
    • 10 ug

CNY 7320.00


SLC26A6 (Myc-DDK-tagged)-Human solute carrier family 26, member 6 (SLC26A6), transcript variant 3
    • 10 ug

CNY 5424.00
CNY 5800.00

Specifications

Product Data
Gene ID 65010
Forward Sequence CCTTATCGGAGGCATCTTCCAG
Reverse Sequence AAAGGGAAGAGATGGCTCCAGC
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...