ApoER2 (LRP8) Human qPCR Primer Pair (NM_004631)

CAT#: HP231155

qSTAR qPCR primer pairs against Homo sapiens gene LRP8



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Cited in 1 publication.

Product images

经常一起买 (8)
Lenti ORF particles, LRP8 (mGFP-tagged)-Human low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (LRP8), transcript variant 3, 200ul, >10^7 TU/mL
    • 200 ul

CNY 14,915.00


LRP8 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


LRP8 (Myc-DDK-tagged)-Human low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (LRP8), transcript variant 1
    • 10 ug

CNY 10,576.00


LRP8 (Myc-DDK-tagged)-Human low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (LRP8), transcript variant 4
    • 10 ug

CNY 6,624.00
CNY 7,130.00


LRP8 (Myc-DDK-tagged)-Human low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (LRP8), transcript variant 2
    • 10 ug

CNY 5,800.00


LRP8 (Myc-DDK-tagged)-Human low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (LRP8), transcript variant 3
    • 10 ug

CNY 7,688.00

Specifications

Product Data
Gene ID 7804
Forward Sequence GAAGCGGAACTATTCACGCCTC
Reverse Sequence ATGAGGACCTCCTGCTCTTTCG
Synonyms APOER2; HSZ75190; LRP-8; MCI1
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...